Description :
Non Conding Region
Location :
Scaffold_1:115430- 115608
Sequence
178 bases(100 bases per row)
CCCAATAATGATTGGCCAGTAGTTAATTTGAGGGATTTTTCACACGTCACATAAAGTTAAATGAGGATTCCACCTCAAACACTGAATATGCAAACTTCCA
GGCGGAGGTGGTGACGAAATATGGGGCTCCTATTCTCGGTCATTGTTGGTGTGGTCGCATTGGGGCGAAGCTGCTAAA