Description :
Non Conding Region
Location :
Scaffold_1:115357- 115563
Sequence
206 bases(100 bases per row)
actttgaattttggctggtcacggacgttttcaatagtcactatcgcgaggtttcaaaaagaaatattggttatggtcagcccaagagctacagagaagc
gatcaaggcccgtggaggacggagaggaaaaggcgaacagcaacgtgcaaggggatgatctagaggagaaagcaccagctccgactaccgagtctgttgc
agttga