Description :
Non Conding Region
Location :
Scaffold_1:115076- 115358
Sequence
282 bases(100 bases per row)
CCTTTACAACTGAAGTGCCAGCACGTCTTTTACAACGAAATCACTAAGGATCGACGATCTGGTGGAGGGTATTTGGAGATGCAAACGCCGAAAGCATTTC
TGTTTAATGAGAAGAAGACAATCGCAAGCGCCGAGGTGGCTCGCTCACAATGGGCTTTGGATCGCGTGATGTGGATCTCAAAGCACAAACGAACGCAGAG
AGGGCAAATAGAAGACGGCTTGTTCACGTCACAAATATCAATCGATCAAAACTCGGCTCGCACCTCGTTGGTGCGCGGTTGC