Description :
Non Conding Region
Location :
Scaffold_1:115010- 117370
Sequence
2360 bases(100 bases per row)
TCAAATCACGGCAGATTTATGTACTGCACACCACATGTACTCAAATGATTGTCCCTTTCCACCTTCCAATACGGACACCTTGGTTTTGTGGCCATCGTTG
CAATTCCACCTTTACCGCATTACGGCACGCATGGTCGAGGACTGGAGTGGCGCCATTGCAGGCCGCAAGCCCCCGCACACGCCACCGTCTCCAAGCATGC
AACAGAAGAGTCAATTCTCCACTCCTTCCATCAGCGTCAGCGTCGTCGTCGCTCCCGATACCTCGAGTCTACCGCCTTTTGGATTAGAATCGTTGTCCCA
CCCCCACCCCTACTTGCAGCAGAGTGATGGTCTACCGCGCGCTACATCCGGGTTACCTTTAGGTCGACGCATGCGGTTAACCCTTGGACAGAAACGCGAG
GTCGTGGACCTCGCTGCGAGCAAGAAGTTCACCCACCGCGAACTGGCCGAGAAGTTCCGCGTCGGTCGCACGACCATTACGAACATCTGCCGGCAAGAAG
AGTTGATCCGCACCGAGACGGACTCGGCCGATGCCGCCAAGAAGAAGCGCAAGACGACCAAGTGCACGTACGACTTGCGCGTGCTGGACGAGTGTCTGCA
CAAGTGGCGGATGGAAGTCAAGGTCTCGAGTCCTGAGACGAAGCTCACGGGCACAGTCGTGCAGCAGAAAGCCATGGAGTTGGCGTGCAAAATCGTCCAA
GAGCCGTACGCGGATCTGCCGGACAAGGTGAAGCAGGCGCTGCAGCGCTTTACGGGCTCCAATGGCTGGCTGGATGGCTACAGAACGAGGTTTGGCTCAT
TTAGCAGCAAACAAGGCCATGGAGAAGGCGAGCCGAGTGTGATTAAAAGCGTCGATATTCAGACGAGATTAAGGGAGTTGCACCACAGTTTCAGTCATGC
GACGGTGGAGGAGATGTGGACAGGCGCGGAGTTTGCTGTCATGTACAAACCGCCAGTGCCGGATGGAAGTGGACCGATCGATGTGAATCATGGACGGTAC
ACGGTGTCGCTGTTTGTAAGTGCTGCAGGAGAGAAGTTTGAGATGCAGGTGATTGGAGTGGAGCGGAATCCGGTGCTACTGGAAGGAATTGATACAAAGG
AGATGTACGATATTCAGTACGAACACTCGAAAACAGGGTGGCAGGTGGCGCAGACGACTGTGAGTATGCTCAAGTCTCTGAATGCACTTGCGCGTGAACG
CAAACGCACGTTTCGAGTGGTGCTGGACTCGGCGGTGCCACATGTGAAGGCTGCAATGATTTTGGATTCGCAAGGCGATCAACGCACGTTCTTTGTGTAC
GATCATCTTCAAATTTACTTTTTGCCGCCGAATTTCACGTCCTTGCGGTTCCATCCGTGCCATCTTGGTGTGATTCAAGCGTTTAAAGCGCGTTTTCGCA
GCGAAATGCTTGAGTCGTTGTTCAGCAGTTATCGGCAGAGTGTGATCAGACAAGACCCGCGTGGTTTCCACCCACAGCGACACCTGTACACGCGCAACGT
TTTTCATTGGCTCTACGTGGCACTCCATAGCCTGGACACACATCTTATTCAGAGCTGCTGGGTCCACAGTGGCTTGCTGCCTACGCATGTGATTGCATCG
CTTAACTTGCGTGTCATGTTGAAAAGTAATGATGTGACTCGGTCATCCGTAAATGTGATTCCATCCACATCTAGTGGCAGTGGTAGCGACAGCACTAGTG
CAAACACTGAAGCTAATGAAGTAAATATTGCGGCTGCGAATGATGATGTTGCTTCGACCGTTACCAATCAAGGAGGTTTGCCGTCTCGGGCACAGTTGTA
CGGCGATCTGCAGCAGCAGCTGACAAATATCGCACGGCTTGCTCCTGACTTTCTATGCTGGATTGGTGTGACTGATCCTAGCGACGCACAGGCATATGCC
GAGATCGACGGCAATGCTTCGGTTATCGATTCAGGTATTGACGAGGTCCAGATCATCCGCAGCGTGTTACAAAAGCACGGGTACTTGTTCACAAAAAAGC
TCGACGATGAGAGTCGTACAGAGGGGTTGCACGAAAGTCTTGACGATGTAGCTGAAGAGCCATGCCCACGTCACGACGAGGTCGTGGCTTCGATAAGTGT
GCTAAAGAAGTATCTGCGTCTATCTCGGGACCCATTACCGTCGCGCGTTGAAGCTGTCGTGCAACTTAACCAAGTCAAGAAAGCAGTCGACGTAGCTGCC
GCCCGTGCAGCAGCCAGTCGTGACGTGTGAACGCAAAGCTGGGTCAAAGTAAGATGTGTGAGTATAGTTATATTCTACGTGTAACTGGCATCGTGTTCAC
CGTATCTCACCGTCGTTGCCTTCCATGTTATACTTGTACCAGCTGGTGACACATCCTAGT