Description :
Non Conding Region
Location :
Scaffold_1:114950- 115128
Sequence
178 bases(100 bases per row)
CATCAGCGACTTCGATATGTGCGCTATATGAAACACGAAAGCATTGTTACTCtttttctccatcttgacgCAGTGTACATCTGCAAGGCCTGGATACCAA
GTTTGTTTGAGAATAAGCGAAACGGTGCAGTGACCCAACAACGTTAATGACAAACCTCTGACAGCATCTCGAGGGGGA