Description :
Non Conding Region
Location :
Scaffold_1:114437- 115532
Sequence
1095 bases(100 bases per row)
TTGGGTCGGAGATGTCGGAGCTTGGGTGCTATTCTAAGAATATACGAATGACTTGCAATCTGTAGAGGGATATCAATAACTTCTCTGCTCTCTCCGACAC
GATACGTCGGAGGTGTGGCTGTGGGACCTTTACGAATCAGCTAGATCTCTGATTGGTTAGAATAAATCGCACAGACTGATTTGATTCGTTATAAGTACAA
CAATTGTCAATCCATTCTTCCTATTGGTCGTTAATATACACAGTGAAGTTAAGTGTGATCGGAGATTTGACGATATTCATCCATATCATTCAATGGCATA
CTGCCTCGTGGCATGGAGTCAGTGGTGTCCGCATGCATGGCAACGTCTGGCAGCAAGAGCTCAACAACAACGTGTGGTTGAGGAATGCCGTACATCTGTA
GCCAGGCCGGCCACGTGTTGACGAAGTTAAATGCGCCTTTCTCTGCGACGTTCGTTGCAATGATTCAGATGTTGGGCTGCAACCGCATCAGGGAATCGCC
GAACAAGCTTATCGGCGTCCCCATGTGGTGCCTCAACGACGACAGTGAAGCCAGAATAAGCTACTCTGGGATGTGATCTCGCCCTGCCATGAGGACTGCC
GTCATGTGCTTCTAGTCTAATTCCGTCGTATATGTGCGCTCAGTCATGAGATAGCGGGGGAAATGCTTCGTGTATCCATGATCCTGCATTTTTTTCCCGT
AGCAAATGTAGCTGTACCATACCGATGATACATCTAGCTGTGTGGGCAACTTTGACAAATGCATAGGTTGTCCCTTTCAATTGCGGGTCTTCCGATCAGT
TACTTTTTTATGTTCTGGCAACATAATGTTTTGATGTTTTAACTGAATTACGGATTGTGTCAACGGAAATCAATGCTGAATACATGTTATGTCAATAATA
GAAATGGATACTTAATCTGTCAACCTTTGCGGTGGCAAGCATGGCAGGCTCCTCCGCTCAGCTGGCCCGCGTGACTGACCGCTCTCCGCTCTTGGTGGCA
TTAAGGACTAGCAGCAACAATGGGTCATCGAAGACGTCAACACACATTGCCATCGTCGTGAAAATTCGCCCAAATTTGCTGCATTTTCTGGTCGA