Description :
Non Conding Region
Location :
Scaffold_1:114403- 115026
Sequence
623 bases(100 bases per row)
TTCAACGAGATACAACCGCGTTATCGATTCACTCGACCATATCTcACCTTGATTTGTGAAACTCCCATTTCCAACGATGTCTGATTGGCTGAAAATGGTT
GGTGGACGCCACTCGACGTGTCCAGCGTAGCTCTTCGCTGTGCCCCATTCATTCCTCAAGACAAGCTCCTCAGGAAGCCCCTCTCCCCTCAAGAaCATCA
aGATGTCTGGACgTGGCATGCGCGGAGGACGTGGCGGCGGTGgCCGCGGTGGCGGTCGCGGTGGAGGCCGTGGCGGAGGCCGTGGTGGCTTCTCCGGTGG
CCGTGGTGGTACCGGTGGCGGTCGCGGCGGTGGCCGTGGCGGAGGCCGTGGTGGCGCCCGTGGCGGCGGTCGCGGTGGTCGTGGCGGCGGTCGTGGCGGC
GCTGCCGgcGGCATGAAGGGCGGCGCCAAGGTCGTGGTGGAACCACACCGTCACGCCGGAGTCTTCATCGCTCGTGGCAAGGAAGACGCTCTCGTCACAC
TCAACTCGACgCCGGGCAAGAGCGTGTACGGCGAGAAGCGCATCTCGGTCGACGTCCCATCGGCCAGCGGAGAGGGCACGGAGAAGGTGGAGTACCGTGT
TTGGAACCCGTTCcGCTCCAAGA