Description :
Non Conding Region
Location :
Scaffold_1:114259- 115666
Sequence
1407 bases(100 bases per row)
GTAGTTGTTGGGTGATGAGGTTGTGCGCTGGGGTTTCTTGGTGTGCGGAGACGCCGATGGGCTCGGGACTTCTGGTCTGCTGCGGTAAAGTGAAGCGAAG
CAGAAATACACCGTAGCAGCGTTTCTGCGGATAAGATCCGCGAAAGTAGATGTCCAGATATAGCGGTATTATAACAAGTTATGTCATTTGTATTGCAATA
TTAGATTTCCTGAATTATACCAAAAACTTGATAACTTGTTTGTTTTTAGATTTTATTAGGATAAATAATTCTATATAATGAAACAGGTGTTAAACTCTAG
AAACGAATGTGATTGACAAATACTTTTCGCAGGGGTTCAAGTTCCGTGGATAGACGAGTGCCATATGTCACTGTCTCGGGGGATGACGCCACTGGCCTTG
AGATTTTCTGAGCTGTGCCGTCAGCATTTTAATCGCCTACATGAGCTCCTGGCTAGAGAGATGGCGTAAAAGATGCTGCCACATTGAAGAATTGTTCCTG
CCCGTGCCGCGCTGGACTGCAGTATGATGACATGCTGAAACAGACACGGCTGTTACTACCGGCGGCTCTCCCGTATGTTCAGACTGAGTTCAGAGCAGGC
GGATCCGAGCTTTGGACAGGCGACGGCTACACTTTGGTGCAGCAAATTACTGGCACGTGCAGCGCATTGCAAGATGCTGGCTACGCCCAAGAACTCATCG
ACCGCGTGCCATCTTTGGTCAGAACGCGTATGATCCTTTGTGTTCCAACTCGCAGAGTGCGTGCTGGTTAAGCAGACAGAAGATCGACAGATGCAGAGAG
AACCCTACAGTTGGTGGTGTAACGCCGTGTGCATCGACTGGCAATTCGATTCAACACTACAGTGCGTACAGCGCCGTCGTCGTGCACAGTAGTTAACAAG
CCAAGCATGCCTTCGATAGATCTTTGCTCTAGCGCATCGCTCAACATTGTTCTCTCAGCGGAGACTTATCGAGTGGATTCGACTATGTACCATATATTTG
GTACACAGATGGTATCCCGCTGTTTAATGACATATATGAATAGTGAGCTCGTTACAAAATTTCAGTTTGAAGGTGTCATTTTAACATCCACCACTATCAC
TTCAAGTCACTAAATCCATGGTTCATCTTCGTACATAAAACGCGGCAATGTGGATGCTTTGCGATACATAACCGTACAAACAACCACGCAAGAACAATCA
CACACGAATGGGACTCGTGCGGCACCAGCTGCTGGAGTCACAAGCACATTTGCGTCCTGCAGATCAGCGACACTGTGTGGCCGCCTGACCAAACGACCAA
ACTTCGCTGTCATCTGGCTGTCTGCGACCGGGTGTTCAGCTCATTGCGCCTTTCGGCGGTTGTGTCATTTGTCCGCTTCGCTGCTAGGCATTGAGTCCCC
TTCAGCA