Description :
Non Conding Region
Location :
Scaffold_1:113997- 123335
Sequence
9338 bases(100 bases per row)
GCAAAGGGTGCAATTATGTTTTTGCGCAATAACTACGTCAATTTTCGTCGGATTGCCCTGAAAATAGTGGGAAATGACGGGGCCTATCAAGACCGTCATT
TAGCCGCCGATTTGACGAAAACCAGGCAAGACGTGAGTGAATTATGGCGAAAAAGCCGTAATTATATGAAATTGACCACCAAGTATGTGTAAAAGGCACA
CTACAATATAGAGGTTTTAGTTTGCTGAATATTTTTATTATATTTCTCCTTCCCTTTATATTGGTATTGACAAGGATTTGTCTTTTATAGGCCTAATTTA
GTTTAATTTGTATTGTTTTTTCATTCTATTGCGCAGGACATTCCTTTACAGAGTCTTTTCATGACGGAGTTTTTTTCTTCGAGTTCTTGTGAATCGAATG
CATATAAAATTGTAAAAATCAACCAATCATGTTACATCAATCCTCTGCTGGGCCCTTCGCGCCCTCGCGGAATGTAAACTATTTATCGTTTGGACAAGTT
CATTTAATTCATTTAAATGAGTGGGGCTCCCTATAGTGATGTCGACATGGAAAATATAGTAGATTGCCGAGAATTGACCACGCGCACAAATTGTTCTGGA
CCGCGCCCCTGCAGTAGGAGTTTGTCGGTCGTTGAACGACAGCACCGATCAAAACAAATCGCCCACATTAAAGTTGGCAAACTTGACACGCGTTTCTTGC
CACGTCGTCCTCTTGCTTGCCGTCGCAGCTTGCCGCTACATGAGTACACGTATCGGTGCAACGTGTCCATGGCGATCTTGAGGCTCACCATACCTGGTTC
CCATAGCGCCATGCAAATCTGTTCTGATCTTGCAAACTTTTCATCCAAGAACACACAGTTCATCGCGGAGTCGAACATAACTTTGCCCGAGGATACCAGG
GTGAATAAGAGTGCGTATTCTTTTCGAGATTCAATGTTTGCGTCGGTCATTAAAGGTTTTAGCAACGAGCGCCTACAAACAAGGACGCTGGGAGTCGTGC
AAGGTCGATTTAGGCATTTACCATGGTTTGTGTGTCCATATTCTTCATTGGGGACAGCATGGACACCCGTTCTTGTAACTCTTGACTATCCGCTTTCTTT
TATGGAGTGGTTGTTATGAAAGGTCGCTTCGCTTGGTCACGAGCCATACAAGTTGGATGCTCGTTTCTGATACATTGAACTGTATAGCATGTTGTTCGAT
GTCAGCACAAGGAGTCTTGCCATTTTGCCATGCAAGAACAGAACGGTGTCGATTGCAATATTCTCAACTTCTTGAAGGGGGCGAAGCGTCATGTTCGGCT
AGATATACTTTTACTTTGTTCCATTGAAAATTTTGCATTGACATTAATTGCTCTTTGTTGTGCTTTCGAGCTCCGTTCGGCCGCCTTTCCATTTAGAAAT
GCCTTATCAGTGGTCGATCTCATCGACCGACCTTTCGGATAATTCATCAAATTCCAGAGATCACAATCTTCGGTGCTTTTGCAGTGAATATTTTTCATTT
TGAAAATTTCTGACTGTTAGAGGAATTACTCATCTCGTAGTCACCTAAGAAGCAATCGTCGCAACTGTCGCCATCACTTTCGATTTCGCTATCCGAGGAG
AAAGGAGTTCCAGCCGCATCGTCTGCTTCGTCGACAGAATCCAGGTACGCGGCCATTTCCACCACTCTGCGATCTGTATGGTCGATGCAGTCAATAATCA
CGCTGCTCGGTAGGCGGTCAAATTCATGATCAAGCCGCTCATGCACGTCAGAGAACGTTGTCGAGGAATCGTACAACCGCCCAACAGTGCCCTTGACGTA
GGCCCAAATTATTTCGATAAGTTGCAGGTCACTATGTTACGGCGGCGTTAAGACGACGTGATGGCCGCGATCCATGGCCATCTGCACGATGGCAGGTACG
ATGTTGGCTGCGATGTGGACTTTAACTTGGCCCATAAAGTTGAACGATATCGACCTGTGATATTGTCTCACACAATCAATTATTCTTAAGTATTTTGTAT
TGATGTATGCATCACTTCTCTCAATATTTGTTCCGTTTCTTCCTGAGCGAGTCATACAATTTGGACATAAACTACAGGGCAGCGTTTTCGCTGATGGCAA
GCCAATGTTACATGTTATCACGAGGAGTGTTAGTGCATATTGTGGGAGCAGTCTACGGTTTTTCACATCCATTTGCGCGAAGTTGGCGTACATTGATATT
CAAAACAGCGCACTAGGAATTTCTTTTGTTGTGAGTGAACCTCAGATCAATGAGGAAGGGAGAATGTACGTTTTAACTTAATGTTTGAGCGAAGTTGTCT
TCTTGGTGCGATAAGATGAAAACAATTTCGCTCAGGTGTGATGTTCAAGACGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTAGGTGTGCATGCATGTGACGTATCAAGAGACGTTCGTCTCTCGATAAACAGCGCGTTC
GCACACTATCGACGAAGCTTGTGATCTCGTCGTAGAGCTCAGTGGCGAGTCCAGGCATTGCGGGCTTGTTGAAGAATGAAAGGTGAATAATCATGCAAAC
CATGCACCATGATCCTTAGGCTGACCAATTATAATGAAGTATGAATTGTCAGATGGCAAACAAATAGACTCCGTCAAAGTTATTATGACACTACGAACGA
ATACACTTTATCAATTGTCGAAGACTACAACTATTTGGATGCAAATTGACTATCATTCTTGACTTTCATTGACCACTTCATGAAGAGTGTACTCTGTTCG
AAGGAATGTGATCAAGTCCATTGTATTCAGAAGAATACGCGCAGAATGAACACAGCAATTTATATGAAAAAAATCATCTATAAACACGAAAATTGTAAAA
ACGGTCGGTCGATGTGTTCGACCACTGTTCATTTTATCCAAATGCAGCGATGAGAAAGATCATACGATTTTATCGAGGTTTTCGAATAAATCAAGACAGT
CGCCGGACAGAGGAAGTATAAAGCAATAATAGCGCAATACTTGGTGTATAGTGCTATTCATATTACCACAAATAGTATGATCTCCAATGACCTGTCGATG
TTACAGACAGTTACGGGGAGGTGACAAGGCACGAGGGAGGGGAGAATATCCGCCGATATTGCAAACCATAAGTAGTGTTGCTGTAGGCGAAGGAGTGAGT
GCACTTTCATGGTAGCTGACGCTAGAAGCAAAATGTCTACACTGGATCGCACGACCACATCCGAGCCACGCACGTCACACACAAGGTCAACGATACCTGA
TACAGTACTTGTAAAAAGAGGGTGGGAGTGTACTTTAGTAGTGGTTCATGACGCCATCATGCACCGATGCACACCCAAAGACCACGCTGAACTTAAAGCA
GGACTCGACTTCAATCACCACAGGCAGCACGACGAGGTCACTCTCAACTTCCAGTGGTCCTGCGCATCACCACGGATAACACTTTACACCAGCTCTAGCG
ACCTCCACCTCGGCGCCCTCCAGAACCTCCACCGGGGA