Description :
Non Conding Region
Location :
Scaffold_1:113815- 115536
Sequence
1721 bases(100 bases per row)
CGAGGCGATGAGAGCGAAATACAAACTCCTACGTTTTGACCCGTTCTGGTTCGATCGAAGGGTGGACAACCACTCTTCAGGGAACCCTCGCGAGCGTGCG
ATTTCATTTGCTTGGCATGTAGATTGGCAACAAGCAACCCCTTGGCGGCGTCTAACGTGGGGTTGCTCTTTTTTTTGTTGGGTTTTTGTGTCCCATGACA
TTCAGTTTGCGCTTCGTTGATCCACACAACATGCATGTTACCGCTACGGCCTCGCCGTCCGCAACGCAGTTGCAACGGGTTCAATCAACGATATACGTTA
ACTGCCCGCGCGCAGTGAGTAGGTTGCGGACGTTGCGGGGCGGTTGTGAATGCCACTTCGTCGACGGTTTTGAAGTGAGTAACAACCGCCTACCTTGTTT
ACTTGCTGTGGTCGCTCGTTTATTTTGCAGTGAAGTGCAAAATGTTGGACGTTCCACGATTCCTCCAGACGCATGTGCGACTAGAAGAATTACTTCAAGA
TCTTCATTTACGGCAATGAAAGCGAAAGGAGAACCGCGAACAAAATTTAGCTGGGTTCACCGGAGCTGCATTGATGGCATCCCAAATGTCTACCGTAGTT
AGTAACGAAGATCAATTTGAGCCACGACCTTTTCAACGGGATCTGCGGTGGTTGTCATGGGCATGGAATGCATGGAGCACGGTGAGCGAGCATGCAGATA
TTAATACACAGTACAATACGTCGCGCGGCGGATTTTGCTGCTTCGCGGCGACACCAACCTCGATTACTCTACGCTTGTTTGGTCTCTGCACTTGGTCACT
GCCGCTGTCACATGGAGGACATACCCGAGGTTTTCACAGCTTTGGTTGCAAAAGTTGAGTGGTAATGAAGGAAACGTTTTATCGTTGCCGCATTGATCTG
CGCTCACGTGACGTTGTGCGCGTCGTTGGTTTTACGGCCGAGCGCTATGTGGCAGCCGTTTCCTCGTGCTAAGTGGTTGTTCTTTTGTGCCGAGCGGGCC
TCATGCTTCATTTCTCCGGACCGAAGGCTATTCCTGCTGGCCAGTGAACCCCATGGGAGCCCGCACCCAACGGCTGCATCTCACAGCTCATATTCTACCA
ACTCCGCTGATGAGATGGGGCATGGAATACCAGTTCAGGACCCGATGGTTGGTCGTGGGCAGCGAGCGTGGAGCGCAAGCCGAAAGGGGGAAggctgctg
tcgtcctcAGCCGACCGGGTGGTGTGGACGCATACAGCGTCGATGGGTGGCTTAGTGTCGTCTGTtgagaagcagaagacgacTGTTGTGTTGATTTCCA
CCGCGCCTGAACCTTCGAGATTCAACCAACAAGCAAGCTATGTCCAGAGCCGGCCGTTAATTAACCCACTCGAAAGGTACAGGTCTCCTGTATCCCATGG
CCAGCCAGCCTCGTGGCCgaaactacatgtacatgagCCCCTTGAGCAGCTGGCGTTTCTCTGAAGCGGTTGTATGTAATGGGCAAGTTGCCGGCAACTT
GTGTCaccgagacgacgaagtgTGCGTGCAAAAGCCGGCCGTCGAGCGTCAACCGCTGTCCAGGACTGCTGGTTTCTGATCGGTCAAGTGCTGTGCCCAa
cgctctctctctctatCTATCTGTCCCTCTCCTGCTTATCCGAGTGGCAAACTCATCCTTTTGTCAGCGTGGCATTCGTGAATTTGCCCGCTTTCGGAAG
CGACGACCGACAAGACAACGA