Description :
Non Conding Region
Location :
Scaffold_1:113547- 113629
Sequence
82 bases(100 bases per row)
CGCGTATTCGTGAATATCTCGCTGGTCGCAGCCTGGAGTTGGGTTTGAAACAAAGCCAATGCCGTTGCAATGAAGGAAATAC