Description :
Non Conding Region
Location :
Scaffold_1:113516- 113573
Sequence
57 bases(100 bases per row)
TTTCACGCTTCACGGTCGAAAATCCACTGCACGCACATTCCAGCTCCATTTGCATGC