Description :
Non Conding Region
Location :
Scaffold_1:113480- 114263
Sequence
783 bases(100 bases per row)
GGACTTAGGGAATCTTCCGGTTAATTGCGAATCCGGATAGGTATCCGGACCCCGGCCCGCTGGTCCGTGCACACGCCCGTAATTCGCTAACTATGCACAA
TATTGTCATTAAAATGCGGTCGCATTCAGCAAAGGACCGTCGGCCCTTGCTGTGCCAAGCGCGAGCGAGCCAGCGTCCGCCATGCAGCAGGTGTCGCCGA
CTCCAAGCCCAGCGATCACCACACCACTGAGGCGACTGGGACGGCTCGCCTGTTGTTACGAGTCGTACTGCCCAAGGAATAAGAGTCGAGGGCTCCTAGA
ACCCGAGCTGCATGCGCCATCTTGGGTGCAAAGGTAGTGCGTCCCTGCCAGGGATACATGCACCTTCCCTGTCCCTTGGGCTACTAGTACAAGCAAGCGT
CGTCGCTTGCTCGAGTGGCACCGAGCGCCTCGTTTCTGCACCCTGCACCCTGCCATCACCTCGTCCTTTACGCAGCCGACGGCCTGCCGTCGCTAGCGGT
ATCAGCAAGCCTCCTCCTAACGTTAGTGTCCTGTCAAGGCTTTGCGCAGATGGTCCTTGCCACTCAAATCACGATGCACCCGAGTACCCAAGCCGCATGC
GCGCTAGCTCTAGACGCACCGTCAAGCTACTATACTGTGAAAGGTGTAGATACACACCGTAGAAGACAATCTGTGCAAAGTTCTGGTGCCAAGGTGCAGG
TTGAGGTTGAAGCCGGACTTAACGGCTGGTTAAAAATACCGGCTGCGTATCCGGATGACCCCGCACCACACGCAAACCGGCAA