Description :
Non Conding Region
Location :
Scaffold_1:113468- 114085
Sequence
617 bases(100 bases per row)
GTGCCGCCGCTATAGGATATGAGCCAGCACCACTTGCACTGTCTTAGGGGATGTTGGTGTGCGGCACACCACTTGGGTCGCCGTTTTAAACCCGTGAGTG
AGTTCGTATTTAGCCGGAGTGCGTGTCTTGCTGGTGATTGGCTCGCGGCCCGTTACACTTGCGATTTGTATGCTGGCGCCTCCGCGGCCAATAGTTTCGC
GGCCCGCACGGCGCCCCAAGCCTCGCCGACTCACGCAGTTCTTCTTGTCTCGTTCGACTTTTGCAGGTAAGCGGCGCTGTTCGGCTGCGATATGACCGCC
TCCAGAGAGGCCAATGCGGAGCGAGGGGATGGAACGTGGTGGTGCGCGTGACGCGCCGCTCGAAACTGGGACGGAGGCCGCGGATACGGCCGGCGGAGCG
CAGGAATTGACGGAGATACAGGCGATTCAAGACTTTTTAGGCTACAGCTGAATGCAGCGCTCCGTCCCGGAAAGATCGCGGCGTTGTCAGTGCCGCCACC
ACTATAGTCACATCCGCGCTGCTGTCCCCCGTCGAACGCAGGCCTTGGAGCGCTCCAGCGATGCCTGGAAGTGCAGTTGCTAATGCGATTCTGGTGATCC
TTATTGTGCTGCTGCAG