Description :
Non Conding Region
Location :
Scaffold_1:113455- 114056
Sequence
601 bases(100 bases per row)
CGAGGGACTCGCCGCCTATTGCCATATCCTCATCAAAAGAAGCCGACGCTGGCGTGAGTGAGGCCAAGCGAAGCCCGCCGCCGGTCGACCGTAACCTAAG
TAATCCAGCGCTACCGTGCGCGACAGAAAAGTAAACACGAATACCCCCCGAAAGCTACCCGAACAAGTATAAAATACACCCGCGAGATTCAGCTTGCGGC
TTGCAATCAGTTGCACACATGGAAGTTTGCGCTCCCACGCTGGCGCCGCCACGTTGGCGCGCGGTTTGTTGGGTTGAAGTGGTCGCATTTCGCTCGCCCA
TGTCGTTTCGCCGCAATCGTCCGTCTCCGTTGTGCGAGATACAGGGTTACGCTCGGTATACAGAACCGTCCGGTTAAAGTAGCTCCACTCCTCACAACGC
AACGATGATGGATTCCTGACGACCGTAACCTGCAACTTACACGGGAGATCCGGGTTCCGATTCGGCATCAAAACCCGATCTGGCCGCTTTGCCCTCATCA
AAACGTTCGGGGGAAACGGAAGCTCCGAGCGAGAGAGAGCGAGCGAGGCCGACCGCCCCATTTAGCGCGAGTCCAGTGCGCGGAAGAAGCCCCGGCCGCC
A