Description :
Non Conding Region
Location :
Scaffold_1:113403- 113633
Sequence
230 bases(100 bases per row)
CAGACATGGTGTTGCCGTTGTTGACCAAGTAAACCTACGCAAGATACTCGTAGTCATGCGAAAGATAAGGGGACTCGCGATGGTACTTCTAACGATACAC
TCGCGGAAATGTGCTCCAATACCAGAATGAACGAAGTCAGGAGGGAAGCTTTTTACCTTGTCGGCGATTGGTTTGTACATTCGTCTCCCCTCACTTATTG
GCCTGCACCATTTCGTGTGATAACGAAAGC