Description :
Non Conding Region
Location :
Scaffold_1:113366- 113548
Sequence
182 bases(100 bases per row)
GGTCCGAAGTGAATCATGTACAGCCCCAAGTCGCTATCAATTTGCCCATCAAAGGAACTCAAAAGAAGATTTCAGATCCGTGAAGTTTTACGAACACGTG
TAGTAGTACCTAAGAGATAGTCTGCAATCAGGTAGGTAGACAATGCTAGTATATGAAGACGAGCACAATGTCCTACCTCTCT