Description :
Non Conding Region
Location :
Scaffold_1:113357- 119052
Sequence
5695 bases(100 bases per row)
AACGACCTGCTTCAAACACCAATTACTCGGTCGCGACCGACTAATTCATCAAGGGCCAAGCCGTCTCAAAACCTCCTGTTGTGGTGAGCTGGATGACGCG
ATGTTTAGCGCTTGCCTCGTGTTGCAGTGCTAGGGTGGACGTGAAGATGCTATGCGCAGTGTGGGGAGGCGTCGACCCATGGCTCACAGCTGAGGCGGTC
GCACTGGCTGATGTTACAAATCTAGAGCGGACAAGACTATTCGATGTCTAGGAGCTAGACGACCCCCTTCTCAAAGTTGGGGCGGGCGGATGACTCGATT
TTCAGGCTTGGGGCGGGCGGACAACTCGATTTTCAGGCTTGGGGCGAGACGGATGACTCGATTTTCAGATTTGGGGCGGGCGGACGACTCGATTTCCAGA
CTTGGGGCGTGACGACCCACTTCTCAAAGTTGGGGTGGGCGGACGACGCGAGTTTCAGACTTGAGGCAAGCCGACCCACTTATTGGAGTTGGGGTTGGCG
GAAGACTCGATAATCAGACTTCGAGATGACCCAGATTGGAGGGCCACAGCCCACACTGCTAGATCGGAAGGCCATGCTGACTACAAATCTGCTGCTGTCG
CGAGCTGGATGACTCGATGTTCAGAGCTTGGCTCGGGTTTCAGCGCTGAGGTGGACCAAAAGATGGCATGCTCAGTGTGGAAAGGTGTGGACCCATGTTC
CACAGCTGAGGCGATGGTCGTGCGGGACCATGCTGGGTCGACGAGAACATCCTGAGCCTTATTCGGCAGTATGATGGAGGTACCGACGATTCTCACGATG
ATATGAATGGATTTACTTGGGCTTTGGGGAATAGATAACTGCGCTCAGTATCGGGCTCCTCAAGAAAATTCAAATTCTGTGTTATGACTTAGGCTATCGA
ATCTTGCAGCCGTCTTCTTAGCGACAGAATATGTCTTACAATGTCAAACGAAATCGTTGGGTGCGAATAAACGCCCTCATCTGGGCATGAAGTCGAGTGT
ACAGAGTCGCTAAGCGCAAGCTTCCGTTCGTCTCCTCCAAGAGCTCGTTCACGGTCTCAGCGGCCTCTTCAAGCGAGAACGCTTCGTTCTTGACCCATCT
TGATCGACAGCACCGGAAGATAATATTGGGCAGTTCTCACATGTTGGAGCTGCTGGTTCTCAGCAAGTAAAGCATCCAGGTCTGTCATTAGCTCTGGGTA
CGTCGAGGGGGCGCGGAGCGGGGAGAGGCGAGGCGAGGCGAGGCGGGAAATGAGACGCACTGGCTTCAGTGGTGGGGGAGGTCCGGGTAGATAATGATCC
ACTATTCGATTTGAGGGGAAACTAAATATTACAGATATTACGATTAGCACGCAGAGTTGTTCGGGCACTGACAAACCAATGGTGAGCGCCACACTAAAGC
ATCCCATCCAATCAGCGATGGCTTTTTCAGTGGGTTTGTACAGAATAATCGCACGGAAATGGTAAGCATACTTGACTATTCTGTATAACAAGCGAGCTGG
CTGCGCCGTAAACGGCGCAGCTCTCTGAGTAGTCACAATTCCGATTAACGTTTTTATTAGCTACCTAATCAACTATACCTTTGTACACAATGTTTAGAAT
GCAATATCCATCCTCCTCTCGGTGCGCGTTGTAGTCGACCGCAATCTTAACATGACGCCTACATGTCGCCCGAGAAAGTGCCACGTACAGCTGACCATGT
GCAAATACTGGTTGTGGTAAGTATATACCAAGCGCCCGTAGTGTTTGCCCTTGAGCCTTGTTAATAGTCATGGCAAACGCGAGTTGAACTGGAAACTGGC
GCCGACGAAGCTCAAATGGCAGACCGGAGTTGTGAGAAATCAATGGGATGCGAGGGATGACGACAACTTTGCCTGTGAGGATTCCTGTCAGCCCTTTAGC
TTCGATGTAGTGGTCGTGCATGTGGCAAACTTGAAGACGTGTTCCATTGCACAGCCTCGCCGTTAATGTTTCGAAGTAAAATGATTGGCGCACCAACCTT
GAGGCGCAGAATATGTGGCGGCATCCCCGATATACTCAGAGAATTTAAAAACTCCTCGGGAAACACGGACGTATCGGACCCTTGCGCATCTTCGACCGTG
TCAATAGATACGTACTCCTTGATTGTCCCTGGGAGTGGTTCGATTGCTGCGTCATTTATCTTCAATACATCGGCATTTACGGCGTCAGAATAGCTCTGCC
CGCAAAGTAGTCATTTTCGAGGTAACGCTCCTCCATACCATCATAAACATCGTCAATAAGGGCCTTTGCCTTTTCCACGTCAGCTGGAGCCGCCAGTACC
ATGTCTTGTTGTATTCGCGTGTAGTCGCGTCCTCCCTCGATACAACCTTGATTCCGGCCTTCTCCAACACGCAGTAGAAAATCAGCAAACGTTTGTGTCT
CCATCGCTGTCGTTTCATTCGTCATACCTTGAACGCTCATGTTGGTCTTGAGATGAAGAATTGAAAAGTTTGTCCACAATGAGGACCGCTTAATGCAGCT
GTTGACGACTTGGCCAGGTGTTCCATGCGGAATTACAGGAAGAATTTGACGGAAATCACCGTCCAACAGCATAACCTTACCCCCAAAAGGTTTGTCGTTC
TTCATGAGATCCCGTAGCGTGATATCAACGGCCTGAAAACCGTACTTAATCATCAGTGGAGCTTCATCCCATACAATGAGAGATGTTTGCCGTAGTAGGT
CGGCTCGATCGGAGCCGACTGTGACGTTACAGGTGGACGTAGATGTGAGGTCCAACACTAGTTGGAATGTATAGTGTGCCGTCCTGCCGCCCATTAGCTG
TGTGGCTGCAATTCCGCTTGAGGCAGCTGCCAAAGCGATTTTGCCTTTCAACCGTGTAGTCGCTAGGATCGTCTGAAGCAAGAAGGACTTCCCCGAACCA
CCGGGGCCATCCAGAAAGAAAAGCTTCTCGTCGCCATTTTCGAGCTGAACAGCGCTGATCACCTTGTCATACACGTTTCTTTGATCGTCATTCAAGCGAT
CGGCTTGATCCCGTAAAGCTTCCATTTCCGCTTGATCGTACGATAGCTCTGCCTCAATCAATCGGTTTGTTGCCGCGTCCGCAGGGTGAAGATCACTAAA
GTCAGCCAACTTGGGCAGACCGCGGAAATCTTCAATTGTCTTGTTGTTGCTGCGCAAGCACTGGTCAACCGCTCGAACAGTCTGATATATCACCTCCCGA
CTGGTTCCGGACTGGTGGAGGTCTCTCTGGAAGTCCTCCGACATGTCGTTCAGGTATGCGTCCCAAAGGGTTTTTGGAGTACCGGGATGACAACGCACTA
AAATGATAGCAAATAGGTGTCGAAGCTGGTTTGGCATCTGATGCTGGCTTGCTTCTTCCATACACCGGTGCCATTCACCATCGCTCTCCAGAAGCCCTCT
TGCTTCCGCTGCAGCTTGGTACGTCTCGTGAATCGTGCCGTTAACAGTCCGGAGATACTCGAACGACATCGGCCCACGGACATTACACAACAGCATTCGA
AGATAGAAACGCTCAGTATCGTTAGGAGAAACCGAAACCATCCGACCAATTGCCTTCTCGCCGTCCTGTTTCCTCGGTTGCCAGTTTTTGACTTCCTTAA
CCCAGGTGTAGTGACGTGGAAATTCGTAGTAAAGGAGCTCTGATGCATCGACATCCGCAGCGCACATTTCAAAGAACCTTGTCAGCATGGTGTGGCGCTG
TTCTGGGATTCTCTCCGGGTGCTCAGGATTAAAAATGGTGTAGTTCATTTCTGGTAGATGAACAGGCAACTGAATCACAGCATGCGACTTCCACTGCATT
GGATACTTCAGCATACGCCAACACACATCAGGAGGACAAATGTATCGACCACTGAGATACTGCTCCACCTCGTCGATATCAATACGCCGATTGGTATTGT
CACCAACATCTGTGACGGGTGCCTCAACGGTAAAAAGTTGCACGATCTTGTCCCTTGTAGATGTACTTGTACATGTACTTGATAGCGTTGATTGTTGAAC
AAATTTCAACGTTGATGTGGCAGTTATACGTCTCGCACAGGTACGGATTGTAAGGAACTACCCAACGATTATCCAGCTCGACAGCATTGCGAATTGTGGA
TCGGCCCTGGTCTCGCCTTCTGTATTCGGGGTAACCAATTTCCTCGCGTGTAGTATCAGAATGAAAATCTTTTGGATAGCCCTCGGAACAAACGCCATCC
TTCATACATGGGGCTTTAGGGTTGAGTATACCACATGGTTCATGGATCATGCATTTCGTCACAGTTTGGTACAACTCGGGATGCGTGTTGGGATCTGGAA
GCTCCGCGCACACAAACTTATCGTAGTCCTCTGAGCGTCTAGGGCTTGAATCTTCCGTAAGTTTCACCAGCATGTGTGCGTGCGGTAAACCTCGTTTTTG
GAACTCGATGACGTAAATCAGCGCCTGCACCTTTCCAAACACTTCATTCTTGATTATGTCGTCCTTGATGGCCTCCAGTTTAAGCTTGAAAGCTCGAGCA
ACCAAGTCCGGCCGGTCAGCGCCCCGCTGATTCTGCAGCATCGCCTCCTTGATATCTGGCCGGATTGCACGTGATGGTGATAAATAGATCGGGCTTGCCT
ATTTCTCGCACGATAGCCATGGAGTCGTAGTACTGCTTGCGCATGTATCTTTCGCCACCTATGAAACTTGGAGGGAGAAGAACAAACCTGCCAACTTCCC
CCAAATTAGCGTCATGGAGTACTGCGTCAATCACGCCACGATAAAGGTCCGCCCGAAATGTACTTTGGTGTAGCTTGATGTAACGGAGTCGTTGGAGCTC
TATCTTCACGTACATTTCAACACACCACTGCTGGAACAGCCGGTATGAGCGATGCAAAATAGAAAATTGGTTTATCCGCGTGAAGAGCTGGTAGACGTAA
AAATCGCGCACTTTCATCCGCTTGTTCTTGTAGCGCACAACACCTGGCTTGTACTCACCTGTGGTTGACCACCCTTGCTCTCCAAACGGAAACAGTAGCG
GAAATTCCAGCGGGTCATAAGCAGGATGCAAGTCGGATATACGTTGAAGACCACCTCCACGACGACTCAAGACGATATCACGCTCCTTTGCCGAATTCTC
GTGGACGATAATTGCTGCAACCTCGTCTGCGGAAGGGCGGTTGTGTGTCCTTTAATCAGTCCCTGGCTGCTCGTGTATCACCAAGCGTAGATCGACACCA
TTTCTTGCCTTCTCTCCGGCGGTAAGGAACTGTTTGACATACGGATTGTAGGCCATTAGCATTTGTTGAAGCGCTTTCACGGTAGGACGATCCAGACCAT
CCAGAATGTGCATTCGTCTGTCCACTTGATGCTCCAAATCCCTGTCGTAGACGTAAACTTGTGCAAAGCTCGGTTCGCTGCCTTCCTCAGGCAGTAATGA
GCCAATTCAATGACAAATCGTACCTTGAACTCGGAATGTGTAGACGCCTTGCCGACCGTTTGCGTAGTTGTTGTCGACGGCAACGTTTTCTCCAATCGAA
GCGCCCATAGAGGCGAAAGCGAGCACGTTGTTGTACGCACGAATCTGGCGGAGAGAAGCAGGAGTCGACACGAACTTCTTGAGGAAAGCCGGTGGATCAT
TTGGAGGGGCGAGGCCGACTCGGCCATCCAGACAGCATGTCGAAGCGTTTTTCGCTCTTCCAGGTCAAAGCGTGACAGTGTATGCACTCCGTGGT