Description :
Non Conding Region
Location :
scaffold_1:113245- 115104
Sequence
1859 bases(100 bases per row)
GTCTCGGTCTCGTCGCCGGCGCTCAGTGGAGCGAGCGTGGACTCACAACGCCTTCGAGGATCGCAGTCCAAGCCCACCACGAGAGGTTAATCCATTGTAT
CGTCCAGAGCCCGAGACTTGGGTATCGCGAGCAGGCGGCGTGTACTTGCCTCGCAAATAGCGTCTATTGCGGAAGCGTCGTCACCTGACATTCTTTCAGC
ACCAGAAGCAAGATGAGCACGCTCCTCCGTGACTGGGACGAAGGTATGTACAGTTGATCGATGGGAACGATACAATAGCTTACCCTTGTTTATTCTGTTC
CTTCAGCCTCGAAGAGCAAGCGGAAGAAGCTTCTGGAATGGTTTTGTAGCTACTTCGATCCGACACAAGATGGCGGTTGGTTATTAGAGAGCGAGTGCGG
GGCAGACGTTGCTCTCTTCTTGCCACGTCTCCTGTCATGGATACAGAAAACCACTGCAAGTGCTGTTTACAATGGCGACGAGGCCTGCAGCTCCCTGAGT
AAGCTGGGAAAAGTAAAATGTTTTGCGCTGGCAGAGCAAGTAGCTTGTCTTCATGTATTCTTCGGGTCGGGGAATGCACACACGTATTATCGAGAGTTCC
AGCATGCGGATGGTCTTCGGTTGGTGCTAAAGATTTTAACCATACAAGGGGAGGACTCCCAAAGTCACAAACCGCTGGTTTCGCTTTCCGACCGAGAGAC
CTTGCTCCGCATCATCCTGCGGATTTCCAAGATGAGTCGGCGGTGCAAGGAGGAGATTAGCTGTCTTGGCGGTGAGCTAGCAGTGATCCACGGGGTGTTG
GCAAGTGGGGACATCGACGATTGGAAAGCAGAGTCTCGTGCGTGGACTCTTTGTCGGGAAGTGCTGCTGGAGCAGCTCGTAGGCAACCCAAACTGTCTCG
ATCAGGCTCACGAGGCCATTGTTTTCATGCTGAGGCATTCTGAAGTGCGTCTCCAACTTTTTGGGGCACAGGTAAATTGGCTTTTGTCTTGAAGTTATCC
ACCACACAGTGACAATCGTTTTGTTACTGAAGGTACTCCGCGAATTAATCTCAGAGAAATCATTCTCATTCGACCCGGAGTATCGACGACGGAAAGAGTA
CGAGCTCGTTCCACTTTGCCTCTTTCTCCTGGAATCGACTGACGTCTACGTCCAGCACGAAAGCCTTGAACTGCTTCATGCTCTTTTGCAGTTGCAAAGA
CTGCAGGTTTGTTTGTTCGCTAATGTTTCGTGTTTCGAAGTAGCATATTTACTGAGTAGGTGCTGCAACAGGATATCATTTGCGACAAGCTCGTTTACTT
GGTCGGAGATAGTGCCAAAACGCTGGATACGTACGGCCTACTGAAAATCTTCTGCTCATAGCTTCGAAGGCGTCGCTAACGCTGCTGTATGCTTTACTTC
CAGCAAGGCTGAGGATCGCTTTGCCTCCATTGAAGATACTACTGAGTATGAAACGTATGTACACCTCCGCTCGGCTTTTGCTCGAACATCCCAAGCTGTC
AACACTCTGATGAACTCAAACCGTAATCTGTTGCCGATTCTGGTAAGCTTACGTTGTTTCATCCAAACCACAGGCCCTGTATTCTTGTTACTCATTGCTA
CCTCTGGAGCAGGTCGATCGGTTTGGTCTACTGACTCCTCTGGCATTTGTACTCGTTATTGAGCGACCACACTCTCTGAAATGGCACGCCGCTGCTATCA
GCGTCCGATTCATCTTGTCGCACCACTACCGGGTACGCATTGAACAATGAGAACCCTTGACAGCTCCAGGATGGACGGACATTTATACAATGTATTGCTC
TATGTCTGGTTGCTATCAGGGAGCAGCTCCATGCATAGCTGAGCTCTTCAACGTTTCAA