Description :
Non Conding Region
Location :
Scaffold_1:113178- 114432
Sequence
1254 bases(100 bases per row)
GAATAAAGACAACGCCTCCAACTTTGTGGAGTCGTGGTGCCGCTGCGCACAGCGTGTTGGGGTATGATGATCAGCAACATGCTTCGTATTCTATTACAGT
ATTCCTACCAGTCTTCTTCGTCTTCGTCGCCACCCAAATCAATGATTTGGGGGCGAGATCGCCGATAGCGAAGCCCACAGCCTGAGCAACTAGGATTAGT
GCCTGGATTGATCAACGTGCAACGTGAGCAGCTCCAAACTTGCGGCGCATCATTACCTGTGCTTTCCTTGTGCTCTTCGTCTGCATGCTCATTTTTCTCA
CAAGCTGGACGTCGATCGCTCAGAACGTCCTCCACGAAGGCGTCATCATCGTCAGAGTCTGTGAGGTCACCAACTCTGAAGTCACTAACTCTTTGCTTCT
TCGGCAAACTATCGACCTCCATCGCAAATGACACCCTCTTCTTCTGGTTCGAGGGCGCTGGCGCGGGAACCACAGAATCTTCAGCTTGAATTGGGAGTGA
TGATGTTTCCAGCGATGAAGCTGGCGGTGTAGGGCGACGTATAGGTGGTTTAGGAGTGCACGAAATATCGGCTTCTGAATCAGCCAAAAGTTCTGATGCC
GACGAGCTGCGCCTTGGAGCCGACAGAAATGCGTCTTCACCCTCGCTCTCTGATTCACTTTCACCGAGGACATCGTCTTGTTCGTGCTCATCACTGGAGC
TTGAATATTCAACCTCCGATTCATCCGACTCAACACCCTTGACCTTCTTGGGCTTCGAGCGCTTGGATTTATTACCCTCTTCATCAGTTCGGCGTTTGTT
TGCGGCATCGATAAGCTCCATACGCTTACGCTTGCGCTCCTCGTCACGCTGGTTGTCTTTCTCTTCATTCTCAGCTTGGTGCTCCTGAAGCAGCTCCCAG
TCGATGCGGCAGCTGAAAGCAAAACTCACCAAATCGTTCTGAACTTGCTGGAGGGCTGCTTGCATGACTTCGTCATCAACAGAAGCATACGATCGATGGT
GCCCCCAGCTGTTTAGGTCTTCTTCAGGGGGCATACCAATCTGTGGATGGTAGCATTTATCCGTGTCCTTGTCAGTATCTTCATCGCTTGTAGTGTCTTT
CTCGGTGGGAGTCTCATTCCCTGTCTCCTCTCCTTTTTCATCATCGTCATCAATCGTAATGACAGAGGGCGATTTATCAGCACCACTAGCCTCATCAGCA
CTTCTCCATCGGCAACGATCGCATTTTAGTTGATCGTGAGTGTCAGACATGGTG