Description :
Non Conding Region
Location :
Scaffold_1:113141- 113561
Sequence
420 bases(100 bases per row)
AGGCGAGATCCAGTAGCTCCAATGTAAGCCATCCCGGATAATGGTCAAAGCTGATGTTGTCGCTTCAACGTGTTTACGCAGCTCCGGCCTCGTGTCGTGT
AATCCGTCGCTTCCGATCTTTTCGCGTCCCACTTAACCTTCCGATCTTTCGATGATTCGCttcgtgttgctgttgtttgTGGCAGTTCTGCcgtggttgc
tgctgtgtgagACTCCGTCCGAGTGGAGATCGCTGCTGAGTTGGTGGaaaggaagacaagaactCGCCTTTAGCCTGGATACGTGGCCGGAACCAGAAAT
CGACGCGGAGGAGTGTCTGACACGTTACCGAGACGGCAAACACAACGAGATCTGCGTCATCAGCCGCTAGAACGAGAGTCCGTAGCTGATTTCAATTGAA
CAGTAAGAAATTATTGCTTT