Description :
Non Conding Region
Location :
Scaffold_1:11273- 12641
Sequence
1368 bases(100 bases per row)
GTGGTGGAGCGGGATCACGAAATTGCTGACGCGATCGCAACTCACCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCCGGCGGA
TCTTGACCTTACAGCTCACCTTGTGTACCCGACGGCTTGGGCGGGTTACGCTCTTCCGGTAATCACGCGAGGGAAGTCAGTGGTGAGCAGGGCAGAACTG
GGGCTTGAGGGCCCTTCAGGGATGGGGGGTGGTTGGCTGCCACGCGGATATGCTTCACGCAGCAGTCGGTTGGGGTGATGATCGTATGTGATCGATCACG
GGGTGTGTCCTTTACGGGGTCCTTTTCGATGCTTGCCGCCTCCTATGGCGGGGTCTTGATGAGTTGGAGAGAGAAGGGGAGCGCACCTGGCCAAGCTATC
CAGGGGCTTCCGCGTTCTCGCTTGAGTCACTTCAGGTGGTTGTCCGGTCGTCGGATAGGCCAATATACTTCCTTCCCCGGAATTCGGAAGACCACTTGCG
TGCTACAAGGAAAATCTCTCTCTGTTTATCCATTTAGAACTACGTGCCTATCCCCCATCTCTCTTGCGTATCTCATGATTGCTGACATTCTTGGACCTCC
GATGTGCCGGTATTTGTGGTACGTGCTGATCTGATCGGCTGATTTGTACCCATGTCAATCTGATCGGTCGATCGGAACCCATGTTGATCCGATCGGTTGA
TCTGAACTCATGTACCCAACATGTGGTACCGCGACCAAATCTGCCAAGATCGGAATGATGGTCTTCACATCCACCATCCGGTCGTCCGACCGTTGATGCC
GCCCATCCCAGGTCCAAAGCCATCCATCCGTACCCATCAACCAATCACCTGGTCGGACACGATCAATCCATCTCCCAAAACTTCTGGTCACTTCTCCACA
CATTTATTGGTCGATCTTGTCGCCCTTCTTTCGCCAGGTGTCTTGGGTCAACCGCCCTCATCCAGAAGTACAAACAACGAGCGCGGGACGCAGCATTGCT
GTTAAATCACACGGGAATACGCTAAATAAACACGCAGCCACCGTCGATCTCGTCTGGCTAGTTAAGTGGGTTCAGGAATTTGCGGCGGAAGTTGGCGAGC
CGTCCCGGTTCGTGTGCGGATCCAGAAGACAATAGATGGGATGATCAAGAAATACTACAGTCGAGAAGATTACACGATGCTGCCAGCCAGCTTCACATCG
GATTCTATCTACGACGAGATGCACGCGTATGTTGAGGAGATTCGCTTGCGCGTCCGGGAGCCTGCAAGATCTACCATGAGGAAGCTGTTGAAGCTTCATT
GCCCTTTGATACGAGTCCGGTCGCCGCAATCTAATGTATGTGATCTGAGCTCCATTACCAGCCACGAA