Description :
Non Conding Region
Location :
Scaffold_1:112703- 115743
Sequence
3040 bases(100 bases per row)
AGGAAGGCGAGGTGTAGTATGACATCCATCCATGAGCGGTTGCCGCCATGGAAAAGGCATGTTTCCATGTGGGGAAATTGTTGTCATGTAAGAGGACTAC
TGGGCTGCCTTGCATGGTCGTGTCACTGCAACCGCCGACACCGCCCGATGGCGCCATCATCCGAGAATTGTGCTCGCACGCCATTGGGCGGTCCACCACA
ACCGGAAAAACGTAAAAGACGCCGTTTTGACCAGGGTAGGTTTAACTCTTCGAGCCCGGGGTTTCGGGGTTCCACATATAATGTTACCGGGGCCGGCCAC
CATCTAATGTACCAGGTATATTAGTATGCTTCAGTGTCCAAGATACAATAGCCACTGCTCCATATAAGCAGCAGGTGGCTACCGGTAATGGTCAAATTAT
GTGAGTACTATCTAGTAAAGTACAGTAGGACTGCAGTGTCGATCTTATTGTCCGGATACGATGTATCCGGACATCTGGTTGTCACCTCCACGAGTTGCAG
TATACTAGTACTTACCAACCCACGATTTGGTGTTAACAGTAAGCGAGCGCATGTCCGGATAAGATTTATCCGGGAAATGAGCCCACCTTGAGAAATTCCC
AATGAATACTCGTAACACATCAGACAGACTACAGTAGTATTCCCAAAATCCAATTTTCACACTTGTCCACAGACCCAGACCAAGCTACGTCCGTATCTGC
AGGTCCGCGGACTTGACGTCCCGTGGAAATCATTTGGAGTATCCAGGCGTACTTAACACGAACTCATTATTTGGTCATCCATACAAATACCAAGTAAAAA
AGTACACTTCGTCGTAGAACAGACCACGTTGGGTAATGTAAAGTAGCAGCTGCGGCATGGCCTATTTATTGTAAATATCTTCCGTTTTTCCCAACAAGAG
GAATCGATAGGACATTCGGTGAGACACACGATTGGGGCTTCCTCCTTACTCCCGCCTGCACAAAATTATACACACGACCACCGCTACGCTACGATGCGCG
CAATTTTGAGGGGGATTCTTTGTAGTACTATTGTACTATAAACAGGCAGGCCAGCGGAGAATGTACAAATTTTGGTCATACTATGATTTTCAAACTTCGT
CCACAGAGCTCAGTAAGCCACAGAGATTTCGGAACGCGTCCTTGACTATTCGGCCATCTTCACATGCCATTTGCACGCTTTCGGAGGTCGGAACAACCGC
GAAAACTTGCATGGCGCATGGGCCCTCGATGGATTCAACGGCCGTCCCTGCGCGTGTCATTGGACACATTTTGTTCTTTCTTCCAATGGAATGCCAGTAA
AAATGTCAGTAACGTTTTTGCATACTTGTAGAACTCAAAATGGATTAGTTAGATAATCAATTATCCTATATATTGTTAATAACCACTCTGGCCTTTCCCA
TAGTAGCTCAAATCTGATTTTAATTAGAGTACGCATTAAAATACATACTTTCGTATTGATGATAACTACTGTACTCGGACATCACACCTGCTCCTTGTTC
TGATTACTCTCCAATCCAGGAAGTAAATCCCCATTGTCCCAAGCTCGTTGGGATAGAACACGAGGTTAAATCATCGAGAAACAGCTCCAACCGAGTTGAA
TGACATGCTCCCACAAGATAGGGCGATGCTTCACTTGCCGCCATTATCCCGTTGTTGACTGCGAGGACGCATGCAAATGCGCTTTAAATCATTTGGTCTT
GGACATTCACAGGGAGCTTCGTCAACAACCAAAGCAAACCACACGTTTTGGAGGTATTTCTACGTGTCTTAACCCGCTCGGATGGACGAGATTTCCCAAT
CTGAATGCCTTTCAGTTCATTCGCGTCAACCCAAAGGTCAATCTACAATGTTCGTCAACACATGTGGTACTTCCCAGTGGTTTGGGACATTCTAAAGAAC
GTACAGCTACTATTAATAGTATGTTACAGTGGTAGAGTCTAAGTTCACTGATGTGGCTGCTCTCATGTAATTGGATGAAACAAAAGTAGTTTTTCTTATT
TGTCCAACAAACGTTCTAGTACCATCGCATGATGGCGAAGCATTGGCTCACACGGAAGAATCTCCAACTCGCACAGATCTTCGTACTACTACTTGAAAGC
ATTTACGCGTGTTCATGAAGGTGTATTCTGTGAATCCCGAGAAGGGGGTGGCATCTGCTAGACGGTGGGAATAGTTCGATGTCGATACCTCCATTTTCCT
AACGTTACGGTGAAAAGTGATTACTGTATAGTTCCCGTGGCCTTTCTGTTAATACAGTAGAACAGTGCATGTCATACAAAGCCTGTAAAAATTTTGCGGT
CCAAAATGGCTCCATACAAATCTTCAAAAGACAATTTTTGAGTGCATTCGCTCTATAAAATTGATAGTAAGACGAATCGACTAATAGAAGCCAATCGTGA
AAATTCACAAAATTGACAAAATGCATGCTGGCCAAGTCACAGTCATTTTGCATTGGAAAGGTGCTGAATTGAACCAATTTTGACCGGATAAGTGGTCTCA
AACCGGATAAGCTATGTTGTGCCGGATAATGCTACAGTAGTAAGTAGTATTTATTTTCGCTGGTTATTTTCCAAAACCCTTATAACGTTCCGTGAATCCT
CTAAATTAATATAGCAACCTCTAGCACCTTATCATATCCTGAATGGAACCAGTTTGTAGAAGTTTGAGGTTTCAGATGACGGGCACTATAGTACATACAG
TACTAGGCTTGGTTGATGTGGGAATGCCGGATTCGTTCAAGGGACCTTACGTGCTTTCCCTATCAGGTGGAGTTACAATACAGTTCAATAACTTGCATAA
TATCCAATCAGCGTCGACCACACCCAGCCCATTTATGTACGAATCGTACTTAGAGGGATTTAATCAACAGACACTTGTACTTCAAGTGCAAGGACTTAAA
AGAGGCACCCAAACACAACACCGTAATTTCCTGTGTAACCATTATATTATACAACTCAGTATACATTAACCAAGTGAACTATAAACTGTATGATTTTATT
TTCAAACGTTGACGTTGTTGAATTTGCACATTTGATCAGA