Description :
Non Conding Region
Location :
Scaffold_1:112453- 113341
Sequence
888 bases(100 bases per row)
GCGTCGGACAATAGCTACGAGTACGAGGCGGCGGGTGGCtctcgtggtggtggacctGCTGAAGCGGAACTGAACTGGCTTTGGCGGATCTGCTGTAGGC
TGAGCAGCGACCGATATGACACGCTTGGGGCTTTGACGCGCTTGGTTGCAGGTCGATGCAgaggcggcgacgatggaaAACAGAgggagcagcaccatcg
agCTTTGGATGGGAAAATGCCCGGACCAGAGACCGCGAACAGCTACGAGCGCGACGTCATTGGTAGAAATGTATACATTACTATCGGCTTGGAGAGGGGT
GGGGGAGTTTGGACCAATCACCGCACGGCAAAACTATTCAGACGCATTTCGGTGCAGCTTTGATGTGGGTATGAGACGGCGCTTTTGAGTCAAAAGTTTG
ACAGGGTCGCCTCTAATATAATTGACGGCAAGCGCCTGTGGGTTTTCAGCAAGCGCAAatgaaggaggagaagaaagCGAAGGCAGCTGCCGCTAGTTCG
CGCAAAAAGTTTTGCCTCTCCAACGGCAAAAAGCATGCCGATTCTGTCGAACATGTATGTACCTTTTGATGACACCATCCAACTTTGTGACCGCGCTACT
ACATCCTTTCACACCGCATTTTACTACATGCGGACAACGCCGTTTGCTTTTACGGTGTGCCGTGGACGCATCCGCCGGCCTCTGCGGAGCGCACCGCAGC
GATTTGTGACCTGAAGCCCGAAATGTAGAGCGCTCCAACGTCACCGCAAATGATGCCACGCGCTCATGTTGCGTGCAAGACACCATGTAGCGTGGACGTA
GCGTGGACGTTGCATGTGGCCCACACCATTGTGAATATGTACACCACTCACTATTTCTAAATGCAGCTTGGTCGTTTCTAAGCAACCa