Description :
Non Conding Region
Location :
Scaffold_1:11238- 11276
Sequence
38 bases(100 bases per row)
GAGCGCGCACATTCAAGGGCTGTATTTTCAAAGGGGTT