Description :
Non Conding Region
Location :
contig_1:112354- 113299
Sequence
945 bases(100 bases per row)
CAAGTTTTTCCCGGCCGATTCATGCCGTTGAGTGCCAAGGAAAAAGATCGGCCGCGATATCAAGAAGAAAAGCGACCTCAAACAGCTAACCTTGCAGGAA
TTTAGACAAGATTTTCCATCAATGCTGCATCAATCGTGATTTCTCTCAACCTGAAGAACTTCTACGGTCATAATCTGTTAGTCAAAGGCATTTATCTTCC
AGATGCTTGCAACAGTGAGGATGCTACTCCTGTTGTTGTCGATGTGCGTAAATTGGAAGTGGCGATAAGCATCCAGCAAAAAAGACAACGACCGCGATGG
GGTTACCTTCGCTGCACCCCTAGCATTCATGTAGTTGCCCTTGCTCAGCTTTGTCGGGGGTATACAGTGTGAGCTTTCATCCTCGCTCTGATCATTGCAA
GGGTTTTTGCGTCTGCCAACCTGGGCATCGCTATTTCACCAGGCTGCGGGCTGGGCTGATCGTTGCCGGATGCTGTTTTTTCGTACCATCAGCCACGAAA
GCGTGTTTCGTACGGAGTTGGACAAGTTCTTCTGCAACCAACGCATCAACGAGGTCAGCACTCAAGAAGGTAACCTCGACAAGCTTCAGGAAATATTTGG
TACGACTTCACCAAACGCGCCGCCGAGGTTCGACCCGATAGAACGTGTGGGAATATATGCCCCTTTATTAAAGAGGTGACCTCGATCTCATTTTCCGAAC
ACGTTCTTGGACTCCTGCAATACCACGGATAAAGTAGACAAGTGGTGCGGACACCGGACTATGGGACTTCCTACAAACACATCTTCGCTGCTGACTCCAT
TCTCAGTGAACCCGGGAAAGTATCGCTCATTTCAGAGACAAGAGCGTGAAAGTGAATTCGATTGGTTGGATTGGTCGTAGCATGGCTACTACCTCCAGCA
AAATCGCCGCAGTAGCATGCGTGAAGCTGTACAAGTCGAGCCATT