Description :
Non Conding Region
Location :
Scaffold_1:112349- 112487
Sequence
138 bases(100 bases per row)
CACGTAGCAACGTATCAAGTAATTCAATGTCAAGTTTGACGTTTGATGGCATCAATTTCATTGCATTGTTGCATTTGTGTTTGCACATAAAATCCGGCTA
AGCTGGGACCCACGCACCTCGGATCCTTCCATGCGCTA