Description :
Non Conding Region
Location :
Scaffold_1:112324- 115178
Sequence
2854 bases(100 bases per row)
TGACCCACTTGCAGCGCCATCATCTGTGCCATAACGATGACATTATGAGCTTTGCGATCTCTGATTCCAAGAGGAACATTGTCGCGACCGGGGAACGAGG
CAAGAAACCCGTGATTCGTCTCTGGGACGCCCACACTGGCGAACTGCGATGCGAAATGAAGGGGTTCCACATCCGCGGTGTGGTGTCGTTGGCGTTCAGC
GCCGACATGAAGATGCTCGTAAGTGTTGGCGACGATGACGACCACTCAGTTGCGCTCTGGGAAGACGCGAGCAATGGCTCGTGGACGTTAGCGAAGCTCC
GTGCAACGTCGAAAGGGGATAAAGGCGTCAACCACTTTGCATCATTTTCTAGTGCTGGCAGCAGCAGTGCCATCGTCACTGGAGGCGCAAAACACGTCTT
GTTCTGGACGATCGAGGGCAAATCCATGACTTCCAAGAAAGGCAAAGTCGGAAAGAAAGGAGTTTTGCAGAATTTCCCCTGTGGCTGCGTGTTTGGGGAC
GAATTTGTGACAGGAACAGCGAGCGGTGAGTTGTACGTGTGGCGAGGTGACGAAGTCTCCAGGATCGTCAAAGCGCACGAAGGTGAGACAACAGTCATGT
ACGCTCACAGTTCGGAGAATCTTGGGATTGCAGACAGCAAAATGGCAGCAACAGGAGTGCTGCTCAGTGGGGGCAAAGATGGCAAAGTGGTGATGTGGAA
TGCGAATTTCCAGTCACTGAAATGCTTCGATTTAGTTGCGATGGATGCGAGGTGCCTTCAGAAAGCCATTTGCAGCGCGTTCCTGAGCACGAATGGTCAG
AAACTGCTTATAGGGACCCGATCCAGCGACATCATCGAGGTGGACGTGTCCTCAGGGACACTGCTCAATGGCGGCAAACCCTTGTTTTCTGGACACTACA
GCTCGGAGTTATGGGGTTTAGCTGTTCATCCGAGTCGCCGAGAGTTCGTGACGACAGGTGACGACGGCACACTTCGCGTGTGGGATATGGAGACCAAACA
GCTCACGCAGCTCACTCGACTTCCGTCGAAATCCCGAGCCTGCGCGTACTCGCCCGATGCCACAGTCTTTGCGATTGGTCTTGGTGGCGACAATGGGGTG
CGGCACAGAGCTACTGGGAAGCAAGGTGGCCAAGCCAAGTCGAAAGAAGGCGCGATCGTGCTCTTGAATGCGCAAACTNNNNNNNNNNNNNNNNNNNNNN
CGCCAAAGTGCTTTTTGAAGATTCCCCGGCGAAGGAATGGATTAGCGATGTGAAGTTCTCGCCGTGTGGTCGGCTCGTTGCATTTGGCTCGCACGACAAT
GCGATCTACCTGTATGCCCTCTCAAATGGGGTGAACGGCGGTGTGCTCGATGCCAAGAAGCGCAAACCGTTTGCCAAGCACAATAGCTACATCACGCACT
TCGATTTCTCCGAGGACAGCAAGTATATCCAGTCGAACTGCGGCGCGTACGAGTACCTCTTTTGCGACACCTCGACCAGTGAGCAAGTGCGCTCGGCGTC
GTCCTTGAAAAACGTGGCGTGGGCCACGTGGACGTGCACGCTCGGGTGGCCCGTGCAGGGCATTTGGCCCGAGTGCGCCGACGGCACCGACATCAACGCC
GTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAGTCTCGTCAAAATCTTCCGCTATCCATGCACCA
TGAAAGGGGTACGTTGCTTGCTAAATTAGTGCTTCATGCGCATGATCCGCTTGGCTGCATGTTAACGCTTGTGTATGTGAATGCTGCTGCTGTTGTATGC
GTCTCAGTCCAAGTTCATTGCCGGCCGCGGGCACGCATCGCACGTCACGAACGNNNNNNNNNNGCGACGACAAGTTTCTCATCTCTCTGGGTGGGAACGA
CCGCTCGATCTTCCAGTGGAAGCTCACGTAGCCAGCCAGCGAGCCTTTCCCGCATATTCAGCACCACGATCACTATCCAGTAAACGCGGCTTTGGGCGTC
GCAAAGGCTCTGGAGTTCGTGCTCGTGCTCGTGCTCATTTTCATGTGGGAGCGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAAACACAATTGCTCCCTATCGCACTTTGGTTTTGGCTCAATTCCTGTGACTTGGCCCAACTTCAAGTTGAAGTCTTGAACGCCCCTGCGCTGGACCTTT
TTTCAACCTTCATCACGCAACAACAGCGGTAATATCAAATCAGAGAGTCTCTCTAGTACGACTCCGTTTGTCGTGTTTTTCCGTGGAAGAAAAGAACCAA
AATCCACAACAGACGAGCCGTCCGTCAAACTGCTTGCTGCAGGGCCAATCTGCTGCTGACGCGCGTGCGTGCCTCGAGGGTGGGACCTACTGCGTGCAGC
CAGCAGTCATCTGCGCGCTGTGCACGACGGATCTTTCGCTACACACACAAAGATCGCGTAGCTACGTCCGTCCATCCATCGCGCTCTTGGTGCTTGGATT
TTCAGCCGCCAGCCAAAAATTAAGTCAAAAATGGTTCGCGTCGCAGCAACTTGTTTTGTTGTTTTTTTGTTGTTTTTGTTGTTTTTGTTTTTTTTGTGAG
AGAGAGACTCAACTACCGACGCACCCACTGTGTGATTAACTTTTTCTTTTAGTTTTATAGTGAGGTGAGATATACCCACACTCTGTGCGTGGCAGAGAGT
GCAATTGCCCCAGACGAAAAAACGAAGGAAAACAGACGGAACGCGAAATGCAAAACGGCACTTTGCGGGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGCGGCGGCATACGTTTTCTACACACTCAACAA