Description :
Non Conding Region
Location :
Scaffold_1:112108- 112254
Sequence
146 bases(100 bases per row)
CGGTCAAAGCTACAGTGAGGTCGGCAGCAGAGAATCGGTAGCGAGATACTTAATATCAACTTGCCAACTTGATACTCCTCGTCGAGTCCTACGCTTGGGC
GCCGCAAGGAGTCGCTCAGCCCTGTGCCATGCCTTCCACTAGAGAT