Description :
Non Conding Region
Location :
Scaffold_1:111871- 112376
Sequence
505 bases(100 bases per row)
CCGCCCTCGTCAGCTACAGAGCAGGACTTGTCGTTTTACTACCTGACCCATTCCCACAAATTGTGGGCCACAATATACTAAATACTGCATTGGTGTCTTG
TTCTGTTACCTTTGCTAGCAAACCAAGTCTGTGTAGAGAATGCGGATAGTAACAACTATCAAGTGCCAGTGGTTCGATGGTGTCAGTCGGGCTTTGCCAC
TCGGCCGGCGTGAGTTCGAGCCCCGCCTCCAACAGAAACGCTTAATTCGTATTTAGGATAGTACTTTACAAACAGTAGCATACTTCGAAGCCCGATGTGT
CTGTGCCATTAGACTAAGGATCGGGTCAATATGTGTGCGATAGCGACACAAAGCGTGTCAGGGTGTCAGTACTGGGTGATTGGTGCAAAAGCGCAAATTA
GTCTCAGAATCTGCCAATCGACGCGCGAACATCCTTTTCCCAACGAATCACAGTGGCGGACGCGAAAGGTCGCGACAGCTTCAGTTTTGGATACGCACAC
AACGA