Description :
Non Conding Region
Location :
Scaffold_1:111818- 112042
Sequence
224 bases(100 bases per row)
ttcagctgctaggggcgttgctgtccacaagtacactggtaatgtgaggcatgagcagctccgttttatgattggcttaaatctatcttaaaaacggttc
ctcatttgctaaaatgaaactttatttaaaaaaatagaattgggtaaaatgaacaatcaattttctgattcgttgaaaatcgcagccaccagaaaactcg
agcacacaggaagaaagctatccg