Description :
Non Conding Region
Location :
Scaffold_1:111809- 115406
Sequence
3597 bases(100 bases per row)
CGGCAACAAAGTCGACCACGCAGACCGAACAGTGCTTGCACGGGTTCTTGTCCATGGATGCGCTGGGAAATGCCCGACCTGTTTTCTTGGCGCGGTCGCT
GGCGATGTCGACATCATTGTTGCGCCGAGTGTGCCAAGATTTTAAGCGGACACACCCGAAGTGGATGCACACGAAAGTGCTGGTCATGAGCAAACTATTG
CCCGATGTCGTTCAAGTGCTGGCAATCGAGTTCCCACAGGCACAACTGCTGTTATGCCAATTCCACGTGCTTCAGCTCCTTAACGATTTACTAGCGCACT
CGCAGATACCGCGTCGGATCTCCAACAAAGATAAAATGCGCGACTGTATTCAACAACTTGTGTTTGCACACTCTGAGTCCAGATATAACGAGGCAAAGGC
TTTGCTCGTGCGGCAGTTGGTTATTGCGGATAAGAGGGAGCTACTTGACACGTTTGATCGAACGTGGGAGCCATACCGTGCGTTCTGGGCGTCGTACGCG
CGAGCGGAGCAGTTCGATTTTTTGCCTTTCCTTACAAAAGGCATGAAAAGCTACTGGGAGCCGATGCAAAGTGCGTTTAGAAGGGCAAGAGATAGCAGCC
TCGTTGGATCAGCGGCCACAACCGTATCTCACTCCACATCCACAGCAACGGCAATCCCTGTTCAAGTTACGACTCCCAATATGTCGTTTCGGTCTACTGC
AAGCGCTGCTGATGGTCAAACCAACCCAGGACGAGCTAGCATGCGACCGCCCTTGATTGTGGTAAATCAGGACACGGAATTTGCAAGAGATACTTCCAGC
ACCCTGCTGGCCAAATGTACAGCTGAAGTGCTAACTACAATCGAGTTCATCGACAGCGGGTGGACATCGAAGATGCTGATCCTCGAGCTTACCAAACCTG
TTACTGTGGATCACTGCGATCCGCTGTTGCTTTTACTGGTAAACTGTGTCAGTAGTTTCGCCGTGGAAGTCATTAGCTCTCAGCTTACTTTCCAGACCTC
AGGCGCCTGCGGCTCCGTGACCGTTACCAAAATTAGGACGCCCAAGGCACACTCGACAAACAGTAAACCCCATTCGAGCGCGTCATCTCCGCCTCCAAGA
CCAACAGCCGCGGAATCTGCGGTGCGCTGGCTAGACAAGACAACTCGTGAGAAGCACATCTTGCATCGAGATGGAAGTACTTGCGACTGCGCGTTCTTCG
CGCTGTACTATCTTCCGTGCCGCCATTTGATTTGGTATGAAGTCGTGGCACTGCAGCACAAGCAGCTCAGCATGGCCGCGGTGGGCCCGCGGTGGTTCTT
GCGGTCATTCCAAGCACCGAAGCTGGCCAGCCAGCGCGAGTCCAACGAGATCGAGTACCACCTCCTCTAATTGCACTATCAAGTTGGCAACTAGCTAGCA
GCAACTCAGAAGCCTTCATCTCCGTGGGGTTTTGGTAGCATGTATTCGATTAATTGCGAAAAAGGGTCCATCTTCAGTCTCGCCATCCAATGACACGCAA
GGGTAATCAAAATGATTGCAGCCGCGTGTCGCAAGGGGACTGCCCATCTCACTGGGCACGTCAGCACCGCAGGCCCACGAGACCTTTGACGAGCCCTGCG
TTCGCTAGCCGGCGATCTGCACTTGTCGCTGATAAAGGTCGGCCGCGTAGAGGCAGCCAGCCAGCTCTGCCTGCCTCTGTGGCCCGGCACAAACGCGCCG
CGGCAGCGCGCGCTCAAGAATGCGTGGCGCCACGCAGTGCCGCGCGTCGTAAGGCAGATCTCTTCCGTTCGTCAAATGGCGGCCACAAAAACTCGCAGCA
GGCGCGTTAAAAACCGTAGGCCCTCCTGCTTGGTGCCGCGAGGTTGTCCGGCGGGCGCGCTACCAAAAGATCGTTAGCATTGCCGCACAGTTTGGCATCC
GTCGCGCAGCGCACTTTCAGTGCGGTCGCCTATGCAGTGCTATCTTCACCGAACAAAGCAAGCATTGGAGACCCTGCCGGTATTTGCAGCCACCGCGCTC
GCCAGACCTCAAAGGCGACCGAAACGAGCAGATTACTCGCGCAGAGAGAACCCGTGTCGCATTTGAAAGTTCCCCTGGGCCTGTCAGCACGCCTGGGGCG
CGCCGACCAGTCTCCAGGGCGGAAGGAAGTCGCACCAAACAAGACTGCGAAAGTGCATGTAGGTAGCGACATGGCGGCAGGAGATTCTTCCCTTGATTGC
GCAGCTGCGTTGGCTACCGACACTTTACCGACATCTCCGGATCACCGACACGAACTCGGTCTTCTCTGCTTGTTTCACAAGTTGTGAACCACAGGGACAC
CATGTAACGTCATTCAAGCAAACAGCAAGCCATACATCACAATGTTTAGCACGACGGCATAACTCTTCGAACGAATCGCCCTTAGCATGCTGAGCTGACT
GTGACATCGGTGCCTCCTCCACCACACACTTCATTCTCGTCAATTTACTAAATATTAACCGCTGGGTTGTCGCTGTCAGCCGCTGCGTTGCAACCCAGAC
CTTCGCGCTAGGGTTCAGCTGTCCCGCGTCGAAGTGATGACGGACGGGCGAGTCCCAGCACCGACGGCCATCGCAGGCAGCACTGTAGAACTCCGGTGGG
GGAGAGACAACAATGTAATGCAGGCCACGGGATCACCAGCGCAAATGCTAAAGGTCCGTGGGAACGGAAGTCATGCCGCCGTCCTCCCGTAGAGAACGCT
AAAATTCAAGGCTCCAACCGAAAGGATCACACCGAATCACTTGTGTCCGGAGCACCGGAGCAGACTCGGCCATCGCGCTGGACTGATGCCGCCGTGAGTG
CTGTTGGCAAACAGTCTGTTGCCGAGGGCTTCGACCGCTGCTAACCCCCTCCTGGGGAAGCTCCCCCCTCTTGTGTGGCGTCGCGGCCAGCCAAAGTGTG
AAACGCAAATTGAGGAGATCTTCAGTAGTGCATGGACAATGGCGTGCCCAAAATACTGCCACTGTTCTGGGCTCGCGTGGGGCGCCGCCATTCCGGTACA
CAAGCGCCCCCGCGCGCTATCGCTGCGGCTGCAAACAAAAAAATCGCTCTGTGAGTGTCTTCTCGATGCCGCTGCGGCGATCGCGCAGACCGTTCCAGTC
GCCGTGGTGCTGCTGTTGAACCTGTCAATCCCATAAAAACAACAGGGCTGAAGCTCCAGGTTTACCGGCGCTATGAAAGACTTGGTCACTGTATTGGCCA
GAAACGGGCCGCACAAAGTGCCCAAAAAGCGATATAAGCTGCGCCCGAAATAATCAACGCCCCGGCTTGGCGCGCCGTCCTATCTTGCTGGCTTCTTCCC
AAGAACTCCTCAGCAAGATTGGTGGCACGGCCTTCGGCTGCGCAGGACGGCCGGGGCCTCTCCATGATGCTCACGGTAAGGCAGGCTTACCGCTCACGCT
TACGAGCCATGCCCTCCGCGACACGCTCGCTTCGCACAGGGAACTCGTTATGTTGGCGACGTCTCCGCGGCTCATAATCTCGTTTAGCGAGCTTCAACCA
CGCCCACGGGCGTCAATCAACGCTGGACTGCGCCATCCACGTTGCGTTCCTGCGAGACCCGGCTTGCACTTCCCGAAAAGTAACTGTGGGTTAATCA