Description :
Non Conding Region
Location :
Scaffold_1:111725- 112720
Sequence
995 bases(100 bases per row)
GCTGCTCACCGCGGCGTAAGTTATTGAGGGGAGCTGGCAGTGCAGTGCGGGAGGGGGAAGATGACGAGCAGCAGCAGGGTGCAGCAGAGCGAGTGAGAGA
GAGAGAGAGAGAGAGAGAGAGCGAGAGCGAGGAAGAGGAGATGATGGACGGGGCAGATCGCGGCGGGCGACGTGCTCCGAGATCTTGATGTGAACGTTGT
CGGTCAGCGGATATGGTGGAAAAAGATCTTCAATATGCTGAATGATCGCCTGCTTCCATACTTGCATGAGTAGCCAAATAGGTCGGATCTTTTGGGGTTG
CGCATGCAGGCGTACCGTATCGCACTGGATGTTGATGACAGTGACCGGTCGTCGGATCGCAAGCATCACTCACCCCCCGCCGAGTGACGTTCGTGATGGC
TAGGAGCGGCAAGCTGTCCCACGGCCGGCTCGCATCTCACCCTAGGTTCAGTCTGGCGGCGTGAGTGTGGTTACCCACCATGATTCGCTGTCGCCTGTCG
TGGCGGGCGACCAATGCGCTGCGACGGCGGCTTCGATCGTCGACCTGCAGTGCCGTCGGAGTGGCATCTGACCCTGCAAGACCGGATATGTTCCGGCTTC
AATGTCGCAGACACGACGGTCAGCGTGGTCGTAAAGCCTTGTGCAACGCATACCCCGATCAATGCGATCCCGGAAAGTTCGGAGGTTCAGGACGGTGACG
CGATCGACGTCGGATGCACGGTACTGCGCGCGGGTTCGGGGTCGAACGCGCCACACCTTCACTCATCTGATGCTGGGTTGCCGCTTTGAGGGGATTCGAT
TGTTCAATCAGGAGCTTCTCCGCCTTTTCCTTGTGGCGCTTCGCCACCTTCAACAAGCAACCGCACGCACAGCAGTTGCCACCGTCGGAGAAGCAGGCAA
ACAGGCAAACAAAAGCCGAAGAGGTCTCCATTCTCGATAATTCGCTTTTGAAGACACCGGCCGACACTTCTTCACTTCACTTCACTTTCCCAGTA