Description :
Non Conding Region
Location :
Scaffold_1:111605- 111767
Sequence
162 bases(100 bases per row)
CCTCCAGGCTGCATCTGTATCGATTCAGATAGAATGCTTGTTGTAAGGCACCTTACCAAGGTATAACTGCAAATTGCCATTTCGTTTTTGTTAGATGATT
GATATCTCGGTAGGCACCGCCCAGCCGCGTGGTGATCGATGCGTTGCTGTCTTTCTGTTGTC