Description :
Non Conding Region
Location :
Scaffold_1:111472- 111651
Sequence
179 bases(100 bases per row)
CCGAGGCTACCTAGTGTAATACCGGTATTTGAAGCTCGTTTAGAAACGAGCCGCTCAGTAATAGATCGATCAAGGGTACCCCGCTTGTTCCCTGTACAAG
AGCATTGCGACGCTCGACTCTCATTTCTAAAAAGAGAGTCAGTCAGTCAGTCAGTCGTCGTCGATCCTTTCGAGCAACA