Description :
Non Conding Region
Location :
Scaffold_1:111336- 111471
Sequence
135 bases(100 bases per row)
GTTAATAGATTTTATGTTGTCTCATTGCTGTCTTTGTTCAATCTGAGACCAAGTCGCTGGGGATGCGCCAGTTACTCTACCTGGTACGTCCTTGCGGGCT
CATTTGAGATTTTTCAGGCTCAAACACAGGAAGAA