Description :
Non Conding Region
Location :
contig_1:111207- 113344
Sequence
2137 bases(100 bases per row)
GTCGCTGCCTGCCCGGGAGAGTCCTGCGTACGGTCGATTCGGTCTCGAAAGGGGAACCGCACGATCAGCGGTACACTGTACCTCTCGAGGCGACTTAACC
GGTTACACTGAACCGGATCGGCTATGAACAGACACCCGAACCGGTTAAGCTTCAACTTGCTTGTTGCCTTTTTTGCCTGTTGCTATATTTGAGCTATTTG
CTATATCGCTTTATTGCTGGGGGAGTCATAGCGAGATGACGCCGACTAGGAGGAAGGAGAAAAAGACCCAGCGCAGAGAGAAGGAAGACGCCGCTCGACA
GTTGACAAGTTTGCTGTCTACAGAGAGCGACAAGTTGAGCGAGCAGCTGCTGATTGCGAGCGAGAAGGGCAGGCAGCGCGCTGTGTTCCTGCTGCTGCAT
CAAGGAGTGGACAAGGACCGATGCAGAGGCCTCGTACGTGGCTGCCAATTGAGAAGAAGGACGAAGGTTGTGAGCTGACTAATTCGTGTTTGCATGTTGC
AGCTCGGCTGCTCTCCGGTGCATCATGCCGCGGCACGAGGTCATTTGGACGTGCTGCAGCTGTTGCTCGACTTTGGGTGGGGTGTGGACGTTCGCAACGA
CGCGCTAGAGACGCCTCTGCATCTCGCGTGCTTCGACGGCCACGTGCACGTTGCAGAGCTCTTGCTAGACCGGGGAGCGGATGTCAACGCGAGAACGAGC
GATCGAGAGACCCCGTTGTTTTACGCGACTAGGAAGGGCCAATACAGAACGGTTCGACTGCTTGTCAGACGGGAGTGCGATCTTGCAGCGGAAAACTGCT
ACGGCGACGTGGCGGAAGAAGAAGCTCGAGATGCAAAAACTCAAGCTGAATTTGCGTCTGGAATCGAAGACTTGCAGCGAACGTCAGCAGTAGAGGGCCA
GCGTGGAGACAGCGGAGAGTATACGCTACCACAAAAACTTCGAGAGCGAGTACTGTCATTTTTAGATCTGAAAAGTCTCGGGTTTGCTTCACAAGTGTCG
TATCGATGGCATCGAGCTTCGGATAATTCCTCGTTGTGGAAGAAACTCGGCGTATCACGGTGGGGATTGCTGCTTAATGCGGCGATGGGAATGGGCACGG
TTCCTCAGATGTCGATGCTACGTACTGCTACGAGCAATCTCTTACGCTTGAATCTCTCGACAACGGTGTCTCGGCGTCCATCGAGCTGTGATCAAGTTTT
TCCCGGCCGATTCATGCCGTTGAGTGCCAAGGAAAAAGATCGGCCGCGATATCAAGAAGAAAAGCGACCTCAAACAGCTAACCTTGCAGGAATTTAGACA
AGATTTTCCATCAATGCTGCATCAATCGTGATTTCTCTCAACCTGAAGAACTTCTACGGTCATAATCTGTTAGTCAAAGGCATTTATCTTCCAGATGCTT
GCAACAGTGAGGATGCTACTCCTGTTGTTGTCGATGTGCGTAAATTGGAAGTGGCGATAAGCATCCAGCAAAAAAGACAACGACCGCGATGGGGTTACCT
TCGCTGCACCCCTAGCATTCATGTAGTTGCCCTTGCTCAGCTTTGTCGGGGGTATACAGTGTGAGCTTTCATCCTCGCTCTGATCATTGCAAGGGTTTTT
GCGTCTGCCAACCTGGGCATCGCTATTTCACCAGGCTGCGGGCTGGGCTGATCGTTGCCGGATGCTGTTTTTTCGTACCATCAGCCACGAAAGCGTGTTT
CGTACGGAGTTGGACAAGTTCTTCTGCAACCAACGCATCAACGAGGTCAGCACTCAAGAAGGTAACCTCGACAAGCTTCAGGAAATATTTGGTACGACTT
CACCAAACGCGCCGCCGAGGTTCGACCCGATAGAACGTGTGGGAATATATGCCCCTTTATTAAAGAGGTGACCTCGATCTCATTTTCCGAACACGTTCCT
GGACTCCTGCAATACCACGGATAAAGTAGACAAGTGGTGCGGACACCGGACTATGGGACTTCCTACAAACACATCTTCGCTGCTGACTCCATTCTCAGTG
AACCCGGGAAAGTATCGCTCATTTCAGAGACAAGAGCGTGAAAGTGAATTCGATTGGTTGGATTGGTCGTAGCATGGCTACTACCTCCAGCAAAATCGCC
GCAGTAGCATGCGTGAAGCTGTACAAGTCGAGCCATT