Description :
Non Conding Region
Location :
contig_1:111162- 111398
Sequence
236 bases(100 bases per row)
GTCGCTGCCTGCCCGGGAGAGTCCTGCGTACGGTCGATTCGGTCTCGAAAGGGGAACCGCACGATCAGCGGTACACTGTACCTCTCGAGGCGACTTAACC
GGTTACACTGAACCGGATCGGCTATGAACAGACACCCGAACCGGTTAAGCTTCAACTTGCTTGTTGCCTTTTTTGCCTGTTGCTATATTTGAGCTATTTG
CTATATCGCTTTATTGCTGGGGGAGTCATAGCGAGA