Description :
Non Conding Region
Location :
Scaffold_1:11102- 11447
Sequence
345 bases(100 bases per row)
TACGTGTCAAATGCAGAGCTTTTGAAAGAATATCATTTGTTTATTGTAAGATGCTAACGACGCTTATAAATGCTCTATGATGCTAAGGAGGAGAAGCGAG
CACTGCGACCCAATTACCAGTACAAGCCTGCGCAAGCACACATAGTCCCGACGACAGACTGAAGTAGGGTCATTTGAGAACCAACCTGAGCAATGGTGTG
TTTGATCAAAAGTACAGAGTTCTTGCTTACTGGCTTCTGCATGCGAGTCTGTCTGTCTGCTTTCGGTGGATTACATATCCGTGTGCTGGGTGTATTCGTT
TCATTTGTGTGCAGGGTGATTGCTGGTGTGGAGTTGCTCGCTCGC