Description :
Non Conding Region
Location :
Scaffold_1:110909- 111553
Sequence
644 bases(100 bases per row)
GACGTTGATCCTGTACCGAACGTGTAACCCTTCGCCAGTGATGTTCCTTTGAACAGAGCTGCATACACAGCTAGCAGTACTATAGTCTTGATCGCATTGG
TGGGAAACATGGAGCACGTAGTCGGCAGAACGGAAAATGACGCGACTCACACGCTTTTTGTCTTCTCCAGTACCGCCGCCAGAGGATCGTCACGGTTTAA
CGAGCGATGTCTCCTTCAAAGCCGTGGCGAATGGACCAACGGAACATATACATACTGAGAAGGCACTGCTTCCAATCACTTGtatgattttttttactgt
cTCGTTGAGCAGCACTGTCCTGCACCCGACAAACGTCGTAACGTGATGGCAAACAGGATTATAAGATTCAAAGAGGGATTGGAGTCCAATCGTTGGACTa
cgtgtaccggtactggtCTACCACCACCACAGGTTACTCGTGTACACTTAATCGACTGGCACGCTCGGGTCCTGATGGAGTTTGCATCAAGAAAAGCGTG
ATGGCATCACGGGGTGATGATAGGAAAAAAGTCcataaaatataaaaaaaaaaagtggTGTGGATAAAACTATGGTGTGGCGCACATAATCCGCTAAGCA
TTATCGTCGCCACACATATCCGCTGCATAGATAGAGGAGCATTA