Description :
Non Conding Region
Location :
Scaffold_1:110877- 111051
Sequence
174 bases(100 bases per row)
AGGTCGATGCGACAATTGTTTTTCTATGTCACAAAAGCTTGGAACGACGTCGTTTAAGCGAAACCAATAGATTTAGTCGCTGTTTTGATTTTCTCATCGT
CTGTGTCTCAGAAATTCTCGACAGCTCCGCCATCTTTATTCTCTGAAACGAGGCAAAGTACACAAGTTGGAAAA