Description :
Non Conding Region
Location :
Scaffold_1:110778- 111110
Sequence
332 bases(100 bases per row)
ATTGGCTGCTGTTTCCGTACTGGTCGAGCAGACATTCAGTGGACATACGAGCGGGACCAGCACCGGTACGATGGCGACTTCAGCGCACGATGTGGTGCCG
TTCGAAGGACGCTTCCCGTCATGGGAAGCCTTCGACGTGGCGCGGAAGGCCCACTGCGAGAAGACGTACACCATGTACGTGTGCCGCAACACCGTCAAAG
TGGCGGTGGCCAACAAGCGCCGCAAACTGCAGGTGCCCGACAGTTGGGTCTACGACCGCAAGGTGCGCTCGTCCGTCCACCTACCGACGAATAGTGTCCA
CATTGGGCCAACACGGCTTACTCTCGTTGATA