Description :
Non Conding Region
Location :
Scaffold_1:110673- 115102
Sequence
4429 bases(100 bases per row)
GTGCGCGAATGAATGCAGCAGCAGCTTCAAGCGCCAAGTGTGCCAATGCACCAAGTGGCTGGTGGTTATTGCTGTCGCTCTTCCCAGCGCCAATCAAACA
ACAAGGGGTTGTATACAACGTTTCATGACACCAGGGTGGTGGGTGATGGGTGGCTTTGTCTACTTACCGATTTATGAGTGGGTTGAAAGCAAAGCGCGAT
ATTTGGGTGAATGGGTATTGGTGGATTTGGCCAACACCGAACTTAAGAGGACTACATTTTGAGGAACAAAAAGTTGCAGTCGGAGTCCCTCCATTTAGTG
GCATGTACCCTAGTCCTAAACGACCAAATCAATCCTCTTGCAACCTTCACATGATAGATAGCAACTTAGCACGAAGTAGTAAGAAAACTACATCATAAGT
CAACTCATACGCGTCTACTTATACTTTCCGTCGACTTTCAAGCGGTACAGTGGGCAGTCCCAGTACCGTGCCCATCCCTATACAGTCGCCCCCGCGCATG
TTCTTATCTCCAGGTGCGCGTCAAAAATTACGCGGCGGTGGCTGCTATGGAAAGCTCCAAACTAAAAGGAAAGCAGGTCATCAGAACGTGCGCCCAGATT
CACTCCGTCATTCCGCCATTCTGCCATATACACGCGCCTAATCCTTCCTTCCTATACACCAGCACTGACACACGCCATGGCCCACGCGCAGCAGCATTCG
GTCTCGATGCACGCGCCGCTGGACGACGACGACCTGCGCTTGTCTCTGGCACTGGACGCGCTCGATGACGACGACTCGGCTGGCGCGCACGACGTGGACA
TGGACATGGACGGCTTGGACGGCGTCATGGGCGGTGCCCGTTGCAGAGACACGGACGGTGACGATGACGACATGGACGGGTTCCGGCCGAGCGCGATGCT
CGATCGCCGGCTCGCGGAGGAGTACGGCGACGCGTTCTACAGCTACTCGACGTGCTTCCAGTCGGCGTCGTCGGAGCTCGTGGAAAAAGATCTCGCCGGC
GGGTTCGTCGACATTGAGCAGATGCTGCTGAACGAGTCGGAGGAGTTTATGACGTCCCAGTTCGAGGCAGGCGCGAGTGCGGGTGGCTTGGATGGCGCAG
TGGCGAGTGCGGACCAACGCACGATGCTCCGCGCAGAAATCACGGCACGCCATTTCCGGCATAAGAGCAATAGCGCAATGAGCAACAGCGGCTGTGCTAG
TGCAGCTAACAATGCGCAATTGGTGCTGCTGAAGCAAGCGATTGCGAGCTCTGCGGTGCCGTCGTCGTCTATATTCAACATGCCGCCGAGATACTTCGAC
ACTGCACAGAGCTCCCCACAGAAGCGGCGTGCGTACCGACGAACGTTTGGCGAGCGCGCGCAGCCATTCGGCTTTGACCGAACGAATCACCAACTGACAT
CATTGAGTATGAAGCACGATCCGCTGGCGGCCCAGCACATGAATCAGCATCACCACCATGCTGCCAGCACTGTGGATGGCGAAGAAAACCGTCCGCCACC
AGCACCAACTGCAGACAAAGTCGACGAGAACGACGACGACGATGAGATGGTACATATTAAAGAAGAAATTGTGGATAGCACGCGTTTTGTAGCCGCTCGC
AGCCTCGTTCCAGTGGCAGCAGATGAATCCATGGGCGACGAAGAGAAGCAACAGTGTGTGGTGATGAAGCAGGAGAGAGTGCAGCAGCCGTCTTTCACTG
GCTTCCGAAGCATCAGCGACGACGCCGACGAGCATTTCCGCCGTGCCACGACGCCGACTCCTTACACGCCAACTATGGACGACGAGGCCACGCTCCGAAC
CCCATTGCGCCGAAGCGTGTCGACGCCGATGCCGGAAGCGTTGTCTGCTTCTTCGAGCTATTACCAGCACCAGACCCCATCGCAACAGTACGTTGCGCAT
GGACTCACCAGTCGGTCCATGTCGCCGGCCGACGCTTTTGAGAAGGTTGCCGTTGTCGTGCAAGTCGCCAAGGACTCACCCGCCCGCATGAACAAGTTTG
AGTGGAAGATCGGTGGCTCAGCGCGACCAGACGCGCTCAAGCGGCAATCGCAGCAGCAGCAGCAACAGCGAAAGATGACGACGCTCTTAGCTGCGGAACT
CGGGAAAGTGGATGGAGACGCCTGTGCACCAGCAGCAGCAGCCGAAGGGGCTCCCTTGACCGCCGACTCGGCGGTCCTCCCGCCTCGGTATTTCCGTGGT
GGCGTCACGAGTTCTCCCGAGAAGCGCCGCGTGCACTCGACGACGTTTGGTTCGTTTGCGCGCTCGTTCTCGTTCACGGGCAACGCGCCACAGTCGTGAG
TTTTGTAAAGTAGGCAGGTAGGTAAGTAGTTTTTATATATGTGTGTGCGTGCTGCTATGGCTGTGGCGATGCACCATCAATCGATACGAGAGAGGCGGGC
GGTAACGCACCACCAAAGTGTGCATACACAGCAGCAGCAAGTGCGTTTTGATCCAAGAAGCAAAAGAGACAAACAAATCTGCAGAGAGTGAGTGAGTTCG
CTGACGAAAGACACAATGGAAACAAGCAAAAGAAAAGCCCGGATGTGAACAATGAAGACGCAAGATACAAACACAATGCTGCATCCGGTATGGGAGCGTG
TGACCAATATCGTGTGGTGGCGAGCGGATCCATTAGCCTGTCGTGGATGCTGACGCCCATGAATACATGATGTGGACTCCACCGTCACTGTCAAGAATCG
TTGGATGCCCACAATGCCTCGTAGCATTTTGCGCTTGAAAGAAAAAAATAGACACTTTTTGAATGCGGCTTTTCGCACATAAGCGCCGATTTTGTCCTTT
GTGAAAGGCTTACGAGCGGTGCTGTCTGCTCTGCCGAGCATGAAGGATACGCTGCACGAAGCCCCCACGGTGCTTGGCATAGCCGCAGTGATCCTTCGAC
CACTGCGCTTTCTGTGAGTCCTCCTGCTTGCATGAGCTTTAAGATGCCATTGACCTGCTCACTTGTGGAATCCACTACAGATTTGACGTGGAGACAGAGA
TTGCCGTCCTGGTGCCGATCGATCAGCGCTCTCCACGTGACAATCTCGATGGGCAGAGCGAGGAGCTACTGGGCCAAGTGCACGTCCGCATCATGCTTTC
CACGCGTCCGCCGTTGATCGAGCGCCAGCAGCTCAGCGGATTCCTTCGGGCCGAGCGACCGAGTCGTGCGACCAACGAACTGGACAACGACGACACTGCA
ATCGACTTGGAGATACGAGCCACGCCTTATTGCGGTGCCGAGAATGCTATACTCGACACTGACATGGAGGAGTTGAGTGGCCTGAAAGGCAGGTTCATAT
GGCTTCTCGTGCGCATGCAAGCGCAGCAGAAAATGCTGCACCAGCGGCTCTGGAATGCACGCGTGCAGTACCAAGTCACGCCTGCCACGGAGAGCTACCT
GCTGCCAATCGAGCACACAAACGTACGTCTCGCATCGATGCTTTAAGTCCGCAAGATGATCTCTGCTGATCTTCATATTTGTTGCGTCGTGCGTCAAACA
TCGCACTAGGTCGTCAAGGTGCTGGTGACGGATGAGCTCCTCGTACAGGTCGACACCAAGACATTGCAGTTCAATTTCCTCTCGCCAATGCCGCAATCTC
CTCTTCCTGCCGCGATCTCACCCAGGTAAGCAAAGCCACGACCATAGCTTCAATGCCATTGCCAGAATCGACTTAACCTCATTGAATTTAGAGACCGCGT
GAACGAGGTACCGGACGAGAAAATCTCGAAATCGCGGCAGGATGATGCAAAACACACCGAAGAGCTGGAGCGCGCTCGGACACTAGCAGAGGCAAATGAA
ACCAAAGCCTCTGTAGCATTGGCATCGGCCCAGGCGGCTGCCGCTGCACTGGAGAGAGAGCGCGAGCAGATCCGAGTGCAGGAACTGGAGCGAAAACACG
AAAAGAGCACGCTTGAGCAGCAGTTTGGCCACGAACGCGCGCTGCTCCAGCAGGAACTCGAGCGCCGAGACGAGCAGAACGGCCAACTGGCGCAGCGCAC
GACACAGTTAGAAGATCAACTACAGGGCAGACAGGATTTCATGGCAGGCTTGCAGCAGGCAGCGAGCAAAACGGACCAAGCCATCGAGGTACGTGCACAT
ATATATCCATTCTTTTACCTTGTTGTGTGTGCGCCTAACTTGATCGTTTTTTTGTCTCTGTACAGCTGTTAAAACAGCGCATTGCAGGCGACTCGAAGGA
GCGCGAGGAGCTACAGCGTCGACTACGGGTCCTGGAAGACGAGAAGCTCGAGCTGCTGAAAAAGAGTCGCGCATGTGCGCTGCAATAGTACACTTTTACA
TATATATAAAAAAGGTATAGACAATATCTCCACTCTCTCCTTCCATCCACTTGTAAGAGAAATAACTTGCACAACGCACGCCATATACATCGAATACTGT
CTTGAACCCATTCGCATCTTCGTCTCAAT