Description :
Non Conding Region
Location :
scaffold_1:110550- 116920
Sequence
6370 bases(100 bases per row)
TTCGTCTCCTGTAAGCGAGTTTCTGCTGATGACGATCAAAAGCTCCGGGCCATGTAGCAAAATACGATATGGATGACAGTGGTGGGCAGCTCCAGTCGGC
CTGCACCTGCGTTCAATCGCGTGTCTACGGAGATGTTGATGCGAGCTGTTCGAAGTGGCGTTCCAGCCTTCTCGACTCTGGTGGACAGCACGATGCGAAA
GTGATTCTGGGACGCAATCCGTCTTCGATGGTTCAAAGACACGGAATATCGGTTTTGGCGGGGAGACGTTTGGAGCGCACTTTTCTCAAATGTCGGTGGT
ATCGAACTGTCGATGAATCCATTCGGAATCGCCAATGCACCGTGTGTAGGGCGAGTGACGAGGAGTCCACCTGGTTTTGATACCTCGAATCATCAGATGC
GCCGTCGATAATTTCGTCTCGATCTCAAAAGAAATCAGACAAAGTGAGCGGCATCGCTGCTATCTTCGGGCGAAGCAAGTTCCCAGCGGCTATTTTATCG
CTATCAGCGTTGGCGCAGAGCATGTCGCGCTCGCACGCCAACAACGCCTCGAGTCACGTGTGGATCGATGGAGATTAGGGTTGAATCGGATGTCAGCGTG
GCACTGGGCCTCGGCGCAGTAAACAGCTCCGCCTCGGATTTGTATTTGTAAAGCGGGCGCGTTGGTAATGTGGAGTTCGCCTGGACGCGGCAGACGAACG
CTGTGAGGCACTTGTTGTCGAAGCTCTCAGTCAGCACAAGTCCGTAAGTCACAGCACAGTACCCAGTGGGTAGGTGCTACGTTTGGCGAACGGCATTCCG
TGAAGCTGCTCAATCCGTTCAGAGGACAACCTGTTTAGGCCTCGAACGGCACAGTTATGCGCTTCGACGCCGAATCTGTCGCATCAGCGCACAGCCCACG
CTTGCTCATACAGAGAGCCTCACCGACATGTCCAACAACAACGACACCTGCAATCTGCGCTCGCAATCGTGCCAGGATCTGTTAAAGTACGAAAGTCTCG
TCGTCTTTTTCTGCATGCATCACTTCAAGTCGTAATCAGGTTGTGGACCACACCAGATAACGTCAACTACTGTAGCCACTACAGTGATGATCTACACTGA
GCACACCTCCATCTCGGTGAATGCTCGTTCAGCACAACTTCTTCACTCTTAAGCACGACCTTAGCACTACTGCATCCGAGAAACTGCGATGCATAATGTG
AAGCCACGAATAAACTCGTGTTCTATGAACGAACGCCAAACACTGAACAGACAGGAATATGTACGCTACACAACCGGCGTGACCCTTGACGCCAGCGACC
GACCAAGCCGTCGATAGTCTTAAGACAGACGACGCTGCAATGGCGGAACTGCTGCTTCGCTGGCTCAACCATGAGCTGGAGCTGTCGACGCACGTGACGG
ACATGGAGGTAGACTTCAGTAATGGCTACCTGCTGGGCGAGATCCTGCACCGCCTCAACCACCAGCACAACTTCTCCGATTTCATGCGCAGCGCTAGTGC
TGACGCCAAGGTCCTCAATTTCTGTCTGTTGGAGCCCACATTACGCAACCTCAACATCAAGTTTGACGCCAATGTGGCCGCCTCCATCATGAACGAGACG
AAGGATGCTGCGGCCAAACTCCTCTACCAGATTAAGGTAAGTCGTCGTCCTGCACTGCAGGAGCCAATGCAATTCTAATATGTTGCTGCTTTTGCACGAA
CAGATTGCTGCTGATCGAGTGGGTAGAGCTCCGGGTGTTTCGACCAAGTCACTAGAGCGGACGGGTATCATTCCGCTACACAATAGACCTGTGAAGCTCG
CAAAGCCGGTTTATGACTCCGAGGAACATCGACAATTTGAGCATTCGATTCGGCGCCATGTGCGATCGATTACTTCGCTACAGCAGAAAAAGTGGGTGCG
GGTATGCTCAACTACAGTGAATAGCGGAAGTTTTATGATGAAAATGGTGCTGTTGCAGGGACCAAATAGCGGAGGAGGTGAAGAAACGAGAAGCTTATCT
GACGAGGATGGCGGAGCAGAAAGAAATGCTTGATGCTACCAAGGCGGAACGACTGCATCGTGCGTTTATTCATAGCAGTTTCATTAAAGAAGCGCTTGAG
GAGACAGACTCACCAGCATGGAGACTGGCGCTGCAAAAGAAGAGTGCGCGCGAACAGCGGCGGGCTGCATTTTTACAACAAATGATGCAGAAGCGCGAAG
AAGCAGAGGTTCGTGCACTGAATGAAGAGTGTAATTCGTGCTGACAGTGCGCTGTGAAACCAAACACAGGAAAATCTCACCTTCAGCTTACGTCGAAAAG
TTCGATGTGATCTGGATGATTTTGATGTGCGTAATGGCTGAGTGTTGATCATTTTTCTTTGCTTGGTGCAGTCTCATGAGAAATGGTGTTCTTATAGGCT
CAACATGAATTGAAGGACACAATTGCAGGTGTCAAGGTTTCGTCTCGGAAATCTGCTGGGTATGGACTACGGTCGCTTACGACAGCGCTCAATACAGCTT
CTGACAAGAAGAAATATTCGACTTCAAACTTGGCCGGATCACCAATGAACGAAACGGAGCTCTATCATGCGAACGTGTTGGAGATGGAAAGCACTTCCGG
CGTTATCAAACAGCAAAAACATCAACGTGAAAAGCGAAAGGAGAATTTATCTCGAAGAAGGAAGCGATTCGTTCAAGAATGTGTTTATTCTCATTCTCGA
ATAGGAACCGCACGTGTAACGAGTATTTTGGAGGATGTGTTGTTACGAGATACGAACAATGAAAAGGATGTACATGGCGAAATGGACAGAATTCTCTTCT
ACAAAGACGTAGCTCGAGAAAACAGGTCAATGCGGAGTCAAGAATATGTGAACCAGCAGGAATTGGACTCGCTAGCGTCAATTGATCGGGATACTAACTC
CTATCATAATCTGCTCCTTCAATTTGAGGATGACAGAGAGATGCAAGTTGTACAACAAAATGACGTCGAAGTGTCCATTAAAGCGGCAGACCGATTCCTT
AGTGAACAGATTTCAAGCGCAGTCATGAAGGAACTGGTGGAGTTCATGCTGTTCATTGCAGGGAGACGTGAGGATACTGTACATTCGAGAGATTCCATCA
CTTTTCTGGTTGACGAAACTTGGAACGAGTATAAAGTTAAGTTTGCAAACGGTTGCAATCTATATCCGTTAACTGCTTCAGAAGTACCAAGTCAACTGGA
GTTACTAGATAGTCACGAACTGCAGCAATACCTGTTAAAGTTTCAGCCATTATTCACTATCAGCGACCAGCAACCCCCATTGACAACGATCAATGATAGC
GCCCTTTTTGTTGGGGCGGTGGAATTCATTAAGGATTGTTTCGTTCTTGGCGAAGAAATTAAGTCATTGCGGTGGATAGCTCGTTTGTCGCCACATACTG
AATCTTGTGCCTTGTTGGATAACGGTGAGCTTAAAAGTGGTAATACTGGATCAAACGTATCTACATCAAATCTACCCATTGCGAGATCCCATAGACAACT
CCGAATTTTAATTTTTGGCCCTCCATTTGCCGGAAAAGAGGAACAAGCAAAACGTCTTGGTGAAACACACAATTTGAACGTACTGTCAGTTCACGAACTT
ATTCAAAATGCTATCCAAAATTCAAGCGCGATTGGTCGGCAAATGAATAACCTTCTGGTCAATGGGATGGAGATTCCTCCCGAGCTGTATAGCCAACTTG
TGATCGAATCCATAGCGGAAACCGAAGAACAACCAATTACACAAAACAACACTATCAAAGCTGGCTGGGTAATTTACGATATGCCTGCAACAGAGCAGCA
CGACCGGAGTTTGGAGGAACATCTTACGGGATATGTGGATCCGGCACTTATGTCTACTCCTTATGATTTTGAATCTGCCATTGCTCCTGGTCGTAGCAAG
CCAGAATTATCTCCAACATTTTTATATGGTAAATCCGGCATAGATCTGGTTTTCCATATCAACTGTCCTGTTGGCACTGTTATAGATCGGTGCTTAGGTC
GAGTCGAGGATGAGACGGCAGGAAATAAGTATCATTTAGTGTTCAACCCACCACCGGACGAGTCAATTGTACGACATCGTTTGCAACACGTTAATCCAAG
CGCGTACTCGAGCGAAATTCTATCACTGCACTGTTTGGCAAACGATGGGTTTTCTTCTGATCATAAAGCTTGGCACGCCAAGTTCAAGACGTTGCACGAG
CCATCCAAAACTGATATGACTGTGAGCGAGATTCACGATGCTATCGCAGAAATTGTGAATCAGTTGCTGAAAGAGAGACAAGCGGAGGCGGAGTCAAAGC
AGCTTCAGCAAGAGGCAGGTGAGCAGGCACTTATGGTGAGTGAAGAAGAAAGACAAAGGCGGTTATACTCCTTTGAATCTGAAATTGACGAGGCGCAGGT
AGAGGTGGCCAAAATCGAGGCATCCATAGCGGAGGCGGAGGAAGCAAAGGCGAAAAAAGAGGAAGTGTTGGAATTTAAACAAAAATTGGATGAGGCTCAG
CATCAGGTGGAGAATGTCGTAACCAGGGTGAAAAGCTGGATGGATGAAGAGAAGTTGTGCCGTCCTGTACCAAGCAGCAAGTATTCGGGCGAGTTGATAC
CAGCAACGGCCCAGGCACTAGCAACATTGTGGAATGATATGGAAACTGCGTATACTTCAACCATGAAAACAAGTTTTGCGTTGCTGCGGAAGCAGCGGCA
TCGCGTTACCGATCGTGCGCAGCTAATGACAAGCGAGTTTTGTGAGTTTGTACGCCGTCCCGACCAGAAACAACAAATTGTCAGTGCGTTCCAAAAACAA
TTTAACGAAGTCGTTGAAGAAATGCGCTTCGACGACCTGACAAAGCTAGAACTGCACGCTCGTGTAGATATCCTGCATGATGAACTGGAATCTCTCATTG
TTACTAAAGTCGCGGCAAACGACGAGGAGTTAAGCAGCATGTTTGGCGATGGATGGATGGAAGGTACGTGCCAACAAGTCGCTGCGATTTATCAAATGGC
ACTCCAGGCAGAATGCGATCGCTTCCGGACTTCAATCCAAATTCTCATAGATGGTCACTATGCTGCAAGCAGCGACCACTCTCAGCTAAGTAGTGTTGTG
GAGATTTGGCACTCTCACCAGTCTCGCTTGGAGTTAGCTTGCAGAATTTATCGTGATCCAGCAAATGAAATGCCAGTAGAGACTCCAGCGCCCGTCGCAA
CAGGGAAAACAGCTCCAAAAGGAAAAACAAAGGCATCCGTTCCCGCCATTGTACCTCCGGCCAACGCGGCTGCATCTAGTGAAGACACTCTAGCAGAGGC
ACTGACGGTGACCGAGTTACTGGCAGAGTACACTCATGTCCTTCAGCGATGTAGCTCATTGATGGAGGCATTTGTTCCAATTGTCAACACTACAGCTGGA
GGTGACGAAGCACACCAGCAGGATATATGCAAGGTGAATTTGCTTAATGGGATCAAATACGAACACAATCAAATGGAACAGCGAGTGCGATACCTTCAAG
AAGCTACTGAGAGATCTCGTGATGAAATTATGCGGACAATGCGTTCCATCGAGCTTACTTTGCGTGGTGTTTTAGAGGATCGAAGAGATCGAGAACAGAT
AGCAGTGGCTGCAGTGGTTGAATATGTCCGGGTTGCCATTGAGGCTGAAGTCGCTCTTCCGTCCTTCATTGATATCAGCGTACGTGTTCTTGTTCTAGCT
TTGAGGATGTCTTACACGGTCTAATCGCTTGTATTTGTTGTAAATACTCCAGCCTGAATTCGTCGAGCGGTTTCCACCAACACTACAAATGCGTGAAGAT
ACAATGGTGCGCATCAACGAAAGCAAACGTTTGCTGCCTCGAACTCCTCCAGATGCACCACCAATTCTTGAAGAAACACACGAGCTGCTTCTCAATCCTC
GTCAACACAAAAGTATTCGGGAGGCATTAACGTCTCAGGCCATCGACAACTCGGGTCTACTTCCTCTCATCACTTTAGTAGAGACCATAACAGCTTTGAC
ATCTCTCCCCGATGCGCTTCCAGACGTCTGGCGTAAATGCCCCGCACACATCATCGCAGAGGTAACCCCCATCGTATACTACAACCATCTTGATTCTAAC
GTGTGGCTTCTTGTACAGATTGCCGCAGGTTTCACCGCCAAGCAGTCAGCATTCGTAGACATCGACGCTTTCCTCACAGCCATGAGTACCCGCGACGACC
TGCTCCATCAGTTCCAACAAGACGAAGCTATACAACAGCTCGAACAGCAGGAACTAGAGCCTCTACAGCAAGAGAACGTAGTCAATGAACCTGCTGCAAC
AGACACAGCAGAATAACAAGAGGTAGACAACAGTCGTGTATTCAGCTACACCGGTCTATATCGTCTGGTC