Description :
Non Conding Region
Location :
Scaffold_1:110536- 111593
Sequence
1057 bases(100 bases per row)
GCAGGAATTCGTCGTTGATGTGAGCTACATAAACCTCTTTATAAGGATTTATATGAGGGTATATTCTAATATGGGGGGGGGGTCATAAAACGTTGACGAG
ACATTGAAGTGAGAGGTTTTGGACTTTAGTTTCGTCGCTTCAGTTCCTTTGTCGGTGCATAAGCAATTAAAATACAGATTGACCGCTTCAAAGTTCTTCC
TCGACGTGAGCAGACATGATAATTGATGGCTTACAAGTTGCACTGATGAACGCTGGAATTTACAACACTTTTTTCAGCAGAGCTCGGGAGCACATTCACG
CTCGTGGACTGTATTCACACAAGAACATTGAGATGAGCATATATATTTTTCATTCACCACAAATGCAGTCTTATTAGAATGCAACATGATGCAAAATGAA
ATTATCATAAGTCTTACTGAGGAGGGTCGCTTGAGCATTGCTCAGAGCATGGGAAAACAAAAACGCTGAAAGTGATCTGGTGAGAGTGCTACGTTTTTCC
TCAAGGATATCTCGACTAAGCTCTTCAGGCTGAATTTTCAGTCCGACGTTCAGATAGACACTGCCATTGCCACTGCCAGTAGTGGCGGTTAACGATCGAA
TCGACACCACAGCGCTCAGCGACACCTCTGCATTCGCTCTGCTTGCAGGTAGATCCTGCAGTAGAACTCCTGTTGTATACCACACACTGAGCTTGTGACA
TGAGATAGCCACGGAAAATGAGCTTGTGCTCATGCATGACGGTGATCGCAGCAACGAGTAATGTAGAATGAGCGATGCAGACAGTACTCGATCGGTCGTA
CACTATATTGGGAGCCGCCCCCAACTACATGAGCAACGAGATCAACCTCTGCATGGATATTGACTGTTCCAGAATTGCAAATTTGAGCTGCCACGACGTT
TTTCTGAAGTGTCATCCACAATTTTCGCAGGTGCGTACGCACATGTTAGGGCCGGTTCCACCATCTCCGACCCCACTCTGCCATATGCTCACTGCCAAAA
GAAGCCGCAAATCGTGACGCTGCAACTCAACGAAGTGGTCCGCTACGTTAAAGAAGA