Description :
Non Conding Region
Location :
Scaffold_1:110509- 110731
Sequence
222 bases(100 bases per row)
CGTCATGAGCCGACCCGGTATACAGTATTTAGTAGGACCACTAGTAAGTAGATCGGAGACCCCGAGACAATAGCACACCACAATGAGCACgTGTACGCGA
TACCGAACGACTGCTTCGTTGTCTGTATTCTCCATCTCTCTTGTCTCTGAGCTCTATCGCCTGACGTGGCCATTGCCATTGcTATTGCCGTGGgCTGCCG
GACGTCTGTCCGTCCGGCCATC