Description :
Non Conding Region
Location :
Scaffold_1:110500- 110853
Sequence
353 bases(100 bases per row)
ACAATTACAGTTTAGTCGCTCAGACTCAAAATATGAATTACTGCGTACACGTACAGTAGTGGTTCCTACGCAACAACCTGCGCGACATCAAACGAGTGAC
ACCATTGCACGTGTTGTGGCAACCTGCACGTGCCAGACGCTTTGCATCTTCATGCCCGCATCCGATTGGCGGAGAGGCAATTTTCTGGCAAAATCAAGAT
TATGCGCACTTTCACGTGATCTGCTTGGTAGAAATAGCGTTTCTCGATTTTTCAGCCAATTACGAGGAACTTGAGCCCGACGGGCAGACGCCATCGTCAG
CGCTCACCTTGCCATACTCAGAATCTCCACGCAAGCAGCAGAGCCCGGAAGCA