Description :
Non Conding Region
Location :
contig_1:110446- 110599
Sequence
153 bases(100 bases per row)
CTGCAATCTCTCCTTCCAAAAACAAACAAACAAAAGCACCCCACACTCCACTCAAAACACCACCTTTTACCCGTTCTTTCTTGAATTGGTTCTCGTTGAA
ATTGCAGCAACGATCTCATCTCTGCACCTGCCGTCAATGCAACCGGGACAGTT