Description :
Non Conding Region
Location :
Scaffold_1:110280- 110492
Sequence
212 bases(100 bases per row)
TAACCAGGCTATACAATTTACCCCATCACACAAGTCGGGTTTTTCAATATACATTTCAAGTAGTCAAGCAATGTCCACATTGGATGGACAGATCTATTGT
GTATGATTAAAAACCACTACTCCTCATTTTTTTCTGTTCGTACTTACTCATCTGTCTCTCTCTCAGTGTCCGCCTGAGCTAGATCGATCATCTTGTATCG
AGATGCTCTCTT