Description :
Non Conding Region
Location :
Scaffold_1:110229- 111567
Sequence
1338 bases(100 bases per row)
CATATGATGGCTCCATCTTTGTTTGCACTTCGACACCTACATATATATATCGCGACATGCAGTCGCAGTTAGTGGTCACAATTGGGGGGTACGTAGGTGC
AGTACATACACGGTGCACACCCAATCTGACGACGAAAGGGTGTAATTAACCGGAAACACTCGACGTGCATGGCTCGTCCACGGGGGCTTTGAGGGGTCGT
AGACTTGCGCGTACAATAAACGATACGTCCGATCGTCCATGGCCCGAACGGCCACGGGGCTGTTGTTGTTATTGGCAGGTTGGTCGAGGCTTTGGAGGCC
TGGGTAGATGTGTATATGTCGTTAAAGCCAGGGAGTAGAAACACACATATTGTACCGTGCAGTAACGCCGCCACCGCCCGGGGCACGTTGTCTGGACATG
TCAAGTACACGACGGCGTCGCCGCGCGGGCGCTTGGTGCGCGGACACATCAACACGTCGATGCGCGGGTACAGTGTCGCAGAGTCTATCTACTCGGAGCA
CCATTCGTCAGCTTAACTAAACCATTTCCAACTACAGAGTAGGAAACCAACGTACTTGGACGCCAAACGGGCGACAGAGACGGGCCAACGTGGCTTCTGT
GACACGGGGCGATGTGGGGAGATAGGACAGGTACAAGCTTCGAGCGACCGTGGCGGAATCGACTACGATGCTGGAAAGGTCCATGACCAGGGGCGGATGG
ACGGTTAAGGCTGTAGTAGTAGTAGTAGTAGTAGTAGTACTAGCAACAGAAGGAGGCGGAACCGATGGGAGGTGGTTGGCGGGTACTACATGTCGTTCGT
GTGAAGGAAGGAGGGCGGTCTTTGGGCCCCATCGACTCACTTCCTTGCGACGACGTTTCAGAGGCGGTTGGGATAAATCTGACGTCGGACTCACAGAGTG
CCGGAGGGTGTCGAGGCTCGATGTACTCGACCGACGACTCAGGGCCGGGGGGCAAGATGGTGAAGATGGTGAAGATGGTGACGCAGGGATGGTCGTTGTG
AGGAGGCTGGACGTGCTGCTGCGACGTGGTAGGCGTGGCGTGTGTGACGTGGTGCGTTCTGGGGACGCGGGGGTCTTGTCTGGTCGGGGCTTTTTTGGAA
TCGCCCATGTGTCTGTGACAACGTGTGGCGGGGGCTTTCGATGGTGGCGATGTTTGGGCTGATGGGGAAGTGGCGACTCGGACTTGTCAGGCGGCGGTGG
CTCGTCACACGGCTTGTTGCTTGACAAAGCAGCGCACGCGTCAGGCATGCCTTCCTCTTGACATGTTAACTGGTCTGCTACGACTAAACTTGGCGGCGTC
CTTTCAACGTCGTCACAGGGTTTCACCGTGTCACAGAT